AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                          --------->ATHB12
                          <---------ICU4           ----------->GT1
                          --------->YAB5         ---------->DOF2
                         <---------YAB1      --------->WOX13(1)
                  XXXXXXXXXXXXXXXXXXXXX>MIR828--------->RVE1(2)
                 ------>ZmHOX2a(1)         <---------KAN1
           --------->HSFC1(2)            <---------ZAT6
           --------->HSFB2a(1)    --------------->AGL15
           <---------HSFC1(2)     <---------------AGL15                         <---------HSFB2a(2)
           --------->ZAT2--------->ICU4  ----------->GT1                   <<<<<<<ZML2
           --------->At4g35610   ----------------->AGL2           --------->ANAC55(2)           ----
---->ANAC46<---------HSFB2a(1)  <---------------AGL15             <---------ANAC55(2)  -------------
-----GT1   <---------At4g35610  --------------->AGL15         --------->RVE1(2) --------->HSFB2a(2)
 
acaaccaggctcgaagcttcctccctacatgattactccaaatagagtaaatcaaagtaaaaacaaatcacataactagaactctagaagattgagacat  16539200
          --------->ANAC58
          --------->ANAC58
          ----------->GT1            --------->GLK1(2)               <---------ZAT2
          <----------ID1             --------->RVE1(2)               <---------At4g35610     -------
        --------->MYB52(1)           --------->GATA12                --------->At4g35610     -------
    ---------->DOF2                  <---------GATA12        --------->LBD16              --------->ANAC58
   --------->AHL20(2)                --------->ARR11(3)  <---------ARR11(2)               --------->ANAC58
------->GT1                          <---------ARR11(3)  --------->ARR11(2)               --------->ANAC46
----------->ANAC81               --------->ANAC46      <---------MYB52(2)            --------->ZAT18
 
agaaaataaaagaacgaaaaaaaccaataggtttacacaaaatctagtaccattcgcatcgaaccgggactaagctgatttaagagattgcacaagacag  16539300
          --------->KAN1
         <---------ATHB12
        ------>MYB83
        ------>MYB46(1)
      <---------MYB111(2)
      --------->AtMYB61
      <---------MYB46(2)                    --------->At5g28300
      <---------MYB55(2)                   ----------->GT1
      --------->MYB46(3)          <---------HSFC1(2)
      <---------MYB111(1)         <---------At4g35610
     --------->ANAC46             --------->HSFC1(2)
  <---------MYB55(2)              --------->HSFB2a(1)                    <-----------GT1
  --------->MYB46(3)          ----------->HVH21               <---------HSFC1(2)            --------
 ------>MYB46(1)            ----------->RAV1(2)               --------->HSFC1(2)--------->ZAT14
 ------>MYB83               <---------At4g35610            <------ZmHOX2a(1)  --------->ANAC46     -
-------->AtSPL8             ------>ZmHOX2a(1)            <---------TOE2(3) --------->MYB46(3)      <
-------->AtSPL3             --------->At4g35610 <---------WOX13(2)    --------->WOX13(2) <----------DOF2
 
taccatccaccaaacatgctctcaattcttcctctgaagcttcccatggtaaattcaaataaggaagtgtctcatttaaccactctactaaactttgatg  16539400
              <---------WOX13(2)
              --------->WOX13(2)
             <---------AHL12(2)
            <---------AHL20(2)
            --------->AHL20(2)
            --------->AHL25(1)
            <---------AHL20(1)
            --------->AHL20(1)
            <---------AHL25(1)
            <---------AHL25(3)
            --------->AHL12(3)
            --------->AHL25(3)
            --------->AHL25(2)                       --------->ARR11(3)
            <---------AHL25(2)                       <---------ARR11(3)
            <---------AHL12(3)                       --------->RVE1(2)
           --------->AHL25(2)                       --------->CCA1(1)
           <---------AHL12(3)                       --------->RVE1(1)
           --------->AHL12(3)                      --------->AHL12(1)
           <---------AHL25(3)                      <---------AHL12(1)
           <---------AHL25(2)                      <---------AHL25(2)
           --------->AHL20(2)                     --------->AHL12(2)
           --------->AHL25(3)                     <---------AHL12(2)
           <---------AHL20(2)                   <---------AHL20(2)
           --------->AHL12(1)                   <---------AHL25(1)
           <---------AHL12(1)                   --------->AHL20(3)     <---------YAB1
           --------->AHL25(1)                   --------->AHL25(1)    <---------AHL20(3)
           <---------AHL25(1)                   --------->AHL20(2)    --------->AHL20(3)
         --------->WOX13(2)                     --------->AHL25(3)   <---------ICU4
   --------->ANAC58                             <---------AHL20(3)   --------->ATHB51
   --------->ANAC58    --------->YAB5           <---------AHL25(2)   --------->YAB1             <---
 ---------->DOF2 <-----------GT1   --------->DOF5.7(1)               <--------HAHB4             <---
->YAB1   <---------WOX13(2)      ---------->DOF2--------->AHL25(2)  --------->ICU4              <---
-------->HSFB2a(2)     <---------MYB46(3)      <---------KAN1       <---------YAB1        <---------At5g28300
---------HSFB2a(2)     ----------->GT1  --------->DOF5.7(1)       --------->YAB5         <----------
 
acctagaagccaaattaaatttacaatggttaagaacaaagagaagacgaataaaatatctgaaaacgaccattattatgcaaaaaacacatttaccttg  16539500
                                                                                               <----
                                                                                               <----
                                                                                               -----
                                                                                            <------ZmHOX2a(2)
                                                                                           <--------
                                                                  ------>ZmHOX2a(2)        <--------
                                                                  ==================================
                                                                <---------RVE1(2)          ---------
                              <-------TEIL                      --------->GATA12           ---------
                              ------>ZmHOX2a(2)                 <---------ARR11(3)   <---------YAB1
                             <------ZmHOX2a(2)                  --------->ARR11(3) --------->KAN1
                            <---------ARR14(2)                  <---------GATA12   --------->YAB1
                            <---------ARR11(2)             <-----------HVH21       --------->YAB5
                            --------->GATA12             ------>ZmHOX2a(2)         <---------ICU4
                            --------->RVE1(2)          --------->GATA12           <---------ATHB12
                            --------->ARR11(2)         <---------ARR11(2)        ------>MYB83------>ZmHOX2a(2)
   <---------YAB5           <---------GATA12           --------->ARR11(2)        ------>MYB46(1)<---
------ANAC58            <---------LBD16             <---------WOX13(1)          --------->WOX13(1)
------ANAC46          <----------DOF2              <---------ANAC46   --------->HSFB2a(2)  <--------
------ANAC58      --------->ANAC46                 <---------ANAC58   --------->TOE2(3)    ---------
-GT1         <----------DOF2--------->ARR14(2)     <---------ANAC58   <---------HSFB2a(2)  <--------
 
cttattgtcatctatactttcacgactttcggatccattagaagactgaatgctgcttgatccgtctgatcttccataaacaccaatcatgctggatcct  16539600
                                                                                                  <-
                                                                                              ------
                                                                                         -----------
  <---------RVE1(2)                                                                   <---------AHL12(1)
<---------YAB1                                                                        --------->AHL12(1)
------DOF2                      --------->AHL20(2)                                   --------->AHL12(2)
-----DOF5.7(1)                --------->WOX13(2)                                     <---------AHL12(2)
->ZmHOX2a(1)                  <---------WOX13(2)                                    <---------AHL12(2)
-ARR11(2)                --------->AtLEC2                                           --------->AHL12(2)
-ARR11(3)       --------->ARR11(3)                                                  --------->AHL12(3)
==HOX2a_HOX2a   <---------ARR14(2)    --------->WOX13(1)                            <---------AHL12(3)
>ARR11(2)       --------->ARR11(2)  ------------>CBF                               <---------AHL12(1)
>GATA12         <---------ARR11(2) --------->ANAC58                                --------->AHL12(1)
------DOF5.7(1) --------->ARR14(2) --------->ANAC58                                --------->AHL20(2)
-ARR14(2)       --------->RVE1(2)---------->DOF2                           --------->YAB1===========
>ARR14(2)      <---------CCA1(2)<---------AHL25(1)                <---------YAB1   --------->AHL25(3)
-GATA12<---------RVE1(2) ----------->GT1      <---------ICU4  --------->WOX13(2)----------->GT1   --
 
tttttgattcgatttttcatatctggacatgtaaattaaagcaattacatcatttcatgagcattagttatcaaactttcataagataaattttcaaaaa  16539700
                                ----------->GT1
                              <---------At4g35610
                              --------->At4g35610
                         <------------CBF
                         --------->WOX13(2)
                         <---------WOX13(2)
       ----------->TGA1 ------>MYB83
       ----------->HVH21------>MYB46(1)                                   <------MYB46(1)
     <---------AtLEC2 <---------------AGL15                         <---------AHL12(1)
 --------->ZAT2       <---------MYB59                               --------->AHL20(2)
 <---------At4g35610  --------------->AGL15               <------------CBF<------MYB83
 --------->At4g35610 ----------------->AGL3             <---------YAB1   --------->MYB59
--------At4g35610    ----------------->AGL2      <---------ANAC58   <---------AHL20(2)
--->YAB1             ----------------->AG        <---------ANAC58   --------->AHL12(1)
------>AGL3         --------->RVE1(2)      --------->MYB52(2)     --------->WOX13(2)
=======================================MADS_MADS <---------ANAC46 <---------WOX13(2)       ---------
------->At4g35610--------->AtMYB61       <---------MYB52(1)   ----------->GT1 --------->MYB52(2)
 
tagctgctgcatgacgaaaaccataccaaattgagctgttataagttagttttcgtattcttattgagtaattaagtaggtttgtttgaaaatataaaga  16539800
                                                                                      <---------AHL25(2)
                                                                                      <---------AHL12(1)
                                                                                      <---------AHL25(3)
                                                                                      <---------AHL12(2)
                                                                                      <---------AHL12(3)
                                                                                      --------->AHL25(2)
                                                                                      --------->AHL12(1)
                                                                                     --------->AHL12(1)
                                                                                     --------->AHL25(1)
                                                                            --------->LBD16
                                                                          <---------LBD16
                                                                        --------->ARR11(2)
                                                                        <---------ARR14(2)
                                                                        <---------ARR11(2)----------
                                                                   <---------ANAC58  <---------AHL20(2)
                                                                   <---------ANAC46  --------->AHL20(2)
                                       ---------->DOF2             <---------ANAC58  <---------AHL20(1)
                    ------------>CBF--------->ANAC58          <---------AHL20(2)     --------->AHL25(2)
                   --------->TOE2(3)--------->ANAC58          <---------AHL20(3)     <---------AHL25(2)
         --------->GATA12     ---------->DOF2                 --------->AHL12(3)     <---------AHL12(1)
    --------->HSFB2a(2)--------->WOX13(2)                     <---------AHL25(1)     --------->AHL25(3)
    <---------HSFB2a(2)<---------WOX13(2)                     --------->AHL20(3)<------NtERF2     --
  <---------ANAC46--------->YAB1  ---------->DOF2           --------->AHL12(2) --------->ANAC58   --
->DOF2   <---------GATA12 <-----------GT1                   --------->AHL12(3) --------->ANAC58  ---
 
aacttgcctagaaatctacaaacatcaatttacaaaagaaagcaaagcctatagctaaaacatatttttttcgtgaaaccggaggcaaaaaatttgtgaa  16539900
                                                                                                  <-
                                                                                                  <-
                                                                                                  --
                                                           --------->ZAT2                         --
                                                           <---------ZAT2                         <-
         <---------WOX13(2)                     ------->GAMYB                                     --
   ------->TEIL                                 ----------->GT1                                   <-
   <---------GATA12                            --------->ANAC46                                   ==
<---------YAB1                               --------->MYB52(1)  --------->ARR14(2)               <-
->GT1    --------->WOX13(2)               --------->RVE1(2)<---------At4g35610            <---------ANAC58
------->YAB1             --------->AHL20(2)<---------ATHB12--------->At4g35610            <---------ANAC46
------->YAB5    <------ZmHOX2a(1)--------->At4g35610 --------->AHL12(1)        --------->CCA1(2)  <-
------>ICU4    --------->ANAC46  <---------At4g35610 <---------AHL12(1)   <---------KAN1  <---------ANAC58
 
atgatgaatctaaattacaggaaacatataaaatactgctgaacaaatcaacggaaaaattcagctcgaattcacgaataagataccaaaatttcgtaga  16540000
        <---------ARR14(2)
        --------->ARR14(2)
--------TGA1a
--------O2
------->TGA1a
------->ANAC55(2)                                                                               <---
--------ANAC55(2)                       --------->ARR11(3)                                 <--------
------->O2                          --------->MYB52(1)              ------->GAMYB <---------MYB46(3)
--------ANAC58                     <---------WRKY12              ----------->RAV1(1)  --------->KAN1
========================================bZIP_DOF           <---------GLK1(2)      ----------->GT1
--------ANAC46                 --------->DOF5.7(1)     ---------->DOF2   --------->KAN1<---------RVE1(2)
--------ANAC58               ---------->DOF2 --------->ATHB12    --------->MYB52(1)<-------GAMYB----
 
gacgtgatgagaaacctcgagagagacttcttgaaaggccaacgatattgaatggtctcaaagaaactcaacagagaaattcagacggttgattctttgc  16540100
<- Previous    Next ->

AGI:  At5g41310.1   
Description:  kinesin motor protein-related. similar to kinesin motor protein-related [Arabidopsis thaliana] (TAIR:AT1G63640.2); similar to kinesin motor protein-related [Arabidopsis thaliana] (TAIR:AT1G63640.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN65659.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO62826.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO68058.1); contains InterPro domain Kinesin, motor region; (InterPro:IPR001752); contains InterPro domain Calponin-like actin-binding (InterPro:IPR001715); contains InterPro domain Calponin-homology (InterPro:IPR016146)
Range:  from: 16533862    to: 16539620    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version