AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                            ------>MYB83
                                                            ------>MYB46(1)
      --------->WOX13(1)                                  <---------MYB111(1)                 <-----
    <---------ATHB12                                      <---------MYB59   <-----------GT1---------
  --------->WOX13(1)                                     <-----------------AGL1           <---------KAN1
--ARR14(2)                  <---------ICU4      --------->RVE1(2)   <-------TEIL        --------->YAB1
->ARR14(2)                  <---------DOF5.7(1)<---------KAN1   <---------TOE2(3) --------->YAB1
--ARR11(2)        <-------TEIL                <---------KAN4(2) --------->MYB59   --------->YAB5 ---
->ARR11(2)       --------->CCA1(2)   ----------->RAV1(1) ----------------->AGL1 --------->RVE1(2)---
 
aaaaacaatcaatctcagagatacaatacaatcttttctccaacacaagaatatacaaatacctacttaggtacaaatttcacaatcacaagaataagaa  16506900
                                          --------->ARR11(2)
                                          <---------ARR11(2)
                  <----------DOF2       --------->HSFC1(2)
                 --------->TOE2(3)      <---------HSFC1(2)
                 <---------DOF5.7(1)    --------->HSFB2a(1)
               ------->TEIL     <-----------RAV1(2)
             --------->ZAT18   <-------TEIL                                         <------NtERF2
             <---------ZAT18  --------->CCA1(2)                                    ------>NtERF2
           --------------->AtSPL8       <---------HSFB2a(1)           ---------->DOF2<---------ANAC46
----ICU4 <---------ICU4       --------->GLK1(2)                   >>>>>>>>>NAM    <---------DEAR3(1)
>YAB1   <---------KAN1     <---------RVE1(2)                 ---------->DOF2     --------->ATERF1(1)
------>YAB1<---------------AtSPL8  <------ZmHOX2a(1)       <---------ZAT6       <---------ATERF1(1)
------>YAB5<---------------AtSPL3 --------->LBD16        --------->YAB1        ----------->HVH21<---
 
tcacaaaactaataagtgtacctttacttagagattcaggagaaggttccatggtatcaatagtgaaagggatgaaagcgagacgacggcgagaagcagg  16507000
                                                                                                ----
                                                                                               -----
                                                                                               -----
                                          <------NtERF2                   <--------ATHB1      ------
                                          <---------------------WRI1      --------->ATHB12  --------
                                         <---------RAP2.3(1)              --------->YAB1    ------->GAMYB
                                        <---------At1g77200               --------->YAB5   <--------
                                        <---------DEAR4(1)                <---------ICU4   ---------
                                        --------->ETT(1)                 <---------ATHB12  <--------
                                        <---------RAP2.3(3)         ------>ZmHOX2a(1)      <--------
                                        <---------DEAR3(1)     =========================MYC_MYB-----
                                     <-----------RAV1(1)       =====================================
                                   <---------KAN1              =====================================MYC_MYB
                                  ------->TEIL                 =====================================
    <---------KAN1             --------->ANAC55(2)             <---------TGA1a       <---------ANAC46
   --------->RVE1(2)           <---------ANAC55(2)             <---------ANAC58      <---------ANAC58
   ------->TEIL             <---------ARR11(2)                 --------->TGA1a       <---------ANAC58
   --------->GLK1(2)        --------->ARR11(2)                 <---------ANAC58<---------ANAC46-----
   <---------GATA12        <-------GAMYB<---------DREB2C(2)    --------->bZIP60(1)  <------NtERF2
  <---------GLK1(2)        ==============================================MYC_MYB --------->ATERF1(1)
--------->ANAC58       ------------>AtMYB77        <---------WOX13(2)    --------->ICU4<------NtERF2
--------->ANAC58       ==================================================MYC_MYB<-------GAMYB-------
--------->ANAC55(2)   ----------->HVH21<---------ORA47(1)      <---------bZIP60(1)<---------DEAR3(1)
<---------ANAC55(2)==============================RAV         <---------TGA2(2) <---------ANAC58-----
--------HVH21      <-----------RAV1(2)<-----------HVH21     ----------->HVH21  <---------ANAC58-----
 
gtcacgaatctcagagagaacctcagggacagttacgaatttgtcggcgaagtttgttaagctctgacgtccttcaatgatggcgttggcgtcaacaacc  16507100
    --------->KAN1
   <---------RVE1(2)
   <---------ARR11(3)
----->LBD16                                                                                <--------
---->ANAC58                                             --------->GLK1(1)                 ------>ZmHOX2a(2)
---->ANAC46                                             <---------At4g35610               <---------DOF5.7(1)
--->MYB46(3)               --------->ARR11(2)           --------->At4g35610             --------->ARR11(2)
->MYB55(1)        <---------GATA12          --------->GLK1(2)    --------->DOF5.7(2)    <---------ARR11(2)
-MYB55(2)         <---------RVE1(2)        <---------GLK1(2) --------->LBD16            <---------RVE1(2)
>MYB46(3)         --------->GATA12      --------->LBD16 <---------GLK1(1)               --------->GATA12
-MYB52(2)         <---------ARR11(2)   --------->LBD16  --------->ZAT2                  <---------ARR14(2)
-MYB111(2)        --------->ARR11(2)-------->P          <---------ZAT2                  <---------GATA12
---->TOE2(3)      <---------ARR14(2)------>MYB83       <-----------ARR10                <---------ARR11(3)
==MYC_MYB--------------->AGL15    --------->AtMYB61   <------NtERF2                     --------->ARR11(3)
===MYC_MYB<----------DOF2  <---------ARR11(2)     ------>NtERF2  <---------MYB52(1)     --------->ARR14(2)
---->RAP2.6(2)    --------->ARR14(2)------>MYB46(1)  --------->LBD16                    <---------AGP1
->P--------->ARR11(3)      --------->ARR14(2)    --------->DEAR3(1)          <----------DOF2
---->ANAC58  <---------ANAC46    --------->MYB46(3)<---------LBD16     --------->LBD16 <---------CCA1(2)
-->GAMYB <---------------AGL15<---------ETT(1) --------->At4g35610   <---------LBD16 --------->ALFIN1
 
gcaatagatattccttttgtggatttgcagtttccgaccatcccgagaatcgctgccggagctccgtcgttaaccggaggctttgaaggtggatctttct  16507200
                                <-------TEIL
                                ------>ZmHOX2a(2)
                               <------ZmHOX2a(2)
                              --------->ARR14(2)
                              <---------GATA12
                              --------->ARR11(2)
                              --------->RVE1(2)                      <------MYB46(1)
                      <---------MYB46(3)                             ----------->GT1
                      <------MYB83                                  <---------MYB46(3)
                      --------->MYB52(2)                         <---------ANAC58
                      <------MYB46(1)                        <-----------RAV1(1)
                 <---------TOE2(3)                   ------>NtERF2 --------->ALFIN1
          <---------ALFIN1    --------->GATA12     <---------RAP2.6(2)     <---------TOE2(3)
      --------->At4g35610     <---------ARR11(2)  <---------At5g28300<------MYB83
 <---------WOX13(2)  <---------AtMYB61        --------->MYB52(2) <---------ANAC58
 --------->WOX13(2) <--------P<---------ARR14(2) <-----------GT1<---------MYB46(3)        --------->CCA1(2)
--DOF2<---------At4g35610  <---------ANAC46 <---------MYB52(1) --------->ALFIN1          <---------RVE1(2)
 
tcacaattgagctccacatcgaggttggtttcggatccatggttttcgttatttgccgcttcaaatgtgggtgggtttaacgaagagactgagagatgga  16507300
                                           <---------bZIP60(2)
                                           --------->bZIP60(2)
                                           <---------bZIP60(1)
                                           =================bZIP_DOF
                                           --------->TGA1a
                                           <---------O2
                                           --------->O2                                        <----
                                           <---------DEAR3(1)                                  <----
                                           --------->bZIP60(1)                             <--------
                                  ------>ZmHOX2a(2)                                       <---------ICU4
                                 --------->CCA1(2)                                        --------->ATHB12
                                 <------ZmHOX2a(2)                                        <---------AHL25(3)
                                --------->ARR14(2)                                        -------->HAHB4
                                --------->GATA12                                          --------->ATHB51
                                --------->RVE1(2)                                         <--------ATHB1
                                --------->AGP1                                           <---------AHL20(2)
                                <---------RVE1(2)                                        --------->AHL12(1)
                                <---------ARR11(2)                                       <---------ATHB51
                                <---------ARR14(2)                                       --------->ICU4
                                --------->ARR11(2)           --------->AHL20(3)          --------->AHL25(1)
                               --------->KAN1                <---------AHL20(3)          <---------AHL25(1)
                               <---------At4g35610           --------->AHL25(2)          --------->AHL25(3)
                               --------->At4g35610<---------DOF5.7(1)           --------->ANAC58
          ----------->GT1     ----------->ARR10  <----------DOF2 --------->AHL20(2)      <---------ATHB12
          <---------ZAT6    *TSS<---------GATA12 <---------DOF5.7(1)       <------NtERF2 --------->AHL20(2)
        ----------->GT1--------->TOE1(2)   <---------TGA1a  --------->ATHB51    --------->ANAC58
      --------->DOF5.7(1)  <-----------HVH21     <---------DAG2  <---------AHL20(2)      <---------AHL12(1)
  >>>>>>>>>TBF1        --------->TOE2(2)----------->HVH21   <---------ICU4 ----------->HVH21   <----
 
gagaagaagaagagtgtaaacaaaaacctaggtcagatccgagacgacgtcgctttttgtccataattttaaatgggcctcacaaggcccaaataattgc  16507400
                                                                <---------ARR11(3)
                                                          ------>MYB46(1)
                                                        <---------MYB59
      --------->AHL20(2)                             ------>MYB46(1)                          <-----
--------->GATA12                                   --------->AtMYB61             <---------YAB5
<---------GATA12                                   <---------MYB59   --------->RVE1(2)      --------
-----ANAC46                                 <---------ZAT6------>MYB83          <---------WOX13(2)
-----ANAC58                   <---------GLK1(2) <-----------GT1 --------->ARR11(3)   --------->RVE1(2)
----CBF           --------->YAB5      --------->ZAT6 ------>MYB83<------ZmHOX2a(2)--------->YAB1
-----ANAC58   --------->RVE1(2) <---------KAN1  <<<<<<<<<GT-1   <---------GATA12<---------TOE2(3)
 
gtagatgtataaaatactatctgattagagctagaatttgaagactagtattaaccaaaccaaactagatcatatcaagggttaatgatatcaaattata  16507500
                                         --------->RVE1(2)           --------->CCA1(2)
                                   ----------->GT1      --------->RVE1(2)
                                   --------->ANAC58     --------->GATA12
                                   --------->ANAC58     ------->TEIL--------->ARR11(3)             -
                                 <<<<<<<ZML2            <---------ARR11(1)             <---------KAN1
                       --------->RAP2.6(3)              --------->GLK1(2)             <---------ARR11(1)
                   --------->TOE1(3)     --------->GATA12<---------KAN1     <---------GATA12       <
                -------->P    <---------HSFC1(1)        <-----------ARR10  --------->GLK1(1)       -
            <-----------GT1   <---------HSFB2a(2)  <---------GATA12 --------->AHL20(1)--------->GLK1(2)
           <-----------GT1    --------->HSFB2a(2) --------->GLK1(1) <---------AHL25(3)--------->RVE1(2)
   <-----------GT1 --------->TOE2(3)--------->TOE2(3)  <---------ARR14(1)  <---------GLK1(1)   -----
   <---------ARR11(2) <---------DOF5.7(2)<---------ARR11(3)        --------->AHL20(2) ------->TEIL -
----YAB1<---------DOF5.7(1)   --------->HSFC1(1)  <---------GLK1(1)<---------KAN1     <-----------ARR10
->YAB1 <----------DOF2--------->MYB52(1) --------->ARR11(3)  --------->AtLEC2        <---------ARR14(1)
 
gttgtgtttcctttttatcaacccttaacggctctagaacgtaaaatctatggaaatcgaatctatgcaaatatatggaaatcgaaacgaatctatctat  16507600
                                          <---------ARR11(3)
                                          --------->RVE1(2)
                                         <---------CCA1(2)
                                        <---------AHL25(2)
                                        <---------ARR11(3)
                                        --------->ARR11(3)
                                        <---------AHL25(3)
                                        --------->AHL25(2)
                                        --------->AHL20(1)
                                        <---------AHL20(1)
                                       <---------AHL12(3)
                                       --------->AHL20(2)
          <<<<<<<<<<AtSR1              --------->AHL12(3)
         --------->ANAC55(2)           <---------AHL25(1)
     <----------DOF2                 --------->AHL20(3)
    <---------DOF5.7(1)              <---------AHL20(3)
    <---------ICU4                   --------->AHL12(3)
-------->ANAC58                    ----------->TBP                                    ---------->DOF2
---------ALFIN1             <------ZmHOX2a(2)                                      <-----------GT1
-------->ANAC46             <---------ATHB12                                  <----------DOF2
---->AtLEC2   <---------DOF5.7(1)  --------->AHL20(2)                        <---------DOF5.7(1)
-------->ANAC58       <-----------GT1<---------AHL12(3) <-----------GT1  <---------YAB5
 
gcacacatctttacgcgtttttttatcaccgatcatctataaatatatctaattctttctaactatttcatagttcatcatctttttcacaaagccaaag  16507700
                                                         --------->YAB1
                                                        <---------ATHB12
                            ----------->GT1            --------->ANAC58         --------->YAB1
                          ----------->GT1              --------->ANAC58        <------ZmHOX2a(2)  <-
         <----------DOF2  <---------ANAC58            --------->WOX13(1)       =====================
    <---------ANAC58      <---------ANAC58          ------------>CBF --------->YAB5<---------ICU4---
    <---------ANAC58<----------DOF2              <----------DOF2  --------->At4g35610         ------
 
tttgtcttcgtgctttctcttaactttgagcgtgaaaaaacacagagtttgtctttgcaatcaacaagaagatgactatgcgatcatcttcaccttcgtc  16507800
<- Previous    Next ->

AGI:  At5g41190.1   
Description:  similar to hypothetical protein [Vitis vinifera] (GB:CAN66411.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO62795.1); contains InterPro domain D-site 20S pre-rRNA nuclease (InterPro:IPR017117); contains InterPro domain Nin one binding (NOB1) Zn-ribbon like (InterPro:IPR014881)
Range:  from: 16504703    to: 16507329    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At5g41200.1   
Description:  AGL75; DNA binding / transcription factor. similar to AGL43, transcription factor [Arabidopsis thaliana] (TAIR:AT5G40220.1); contains InterPro domain Transcription factor, MADS-box; (InterPro:IPR002100)
Range:  from: 16507772    to: 16508764    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version