AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                        --------->KAN1
                                                                       <---------ZAT14
                                                                       --------->ZAT14
                                       <---------ARR11(3)              --------->ARR14(2)
                                       --------->ARR11(3)              <---------ARR14(2)
                                       --------->ARR14(2)              --------->ARR11(2)
                                       <---------ARR14(2)              <---------ARR11(2)    <------
                                      <---------CCA1(2)           <---------ANAC46           -------
                                    <------MYB46(1)      --------->ARR14(2)         <---------ARR14(2)
                                  <---------MYB52(1)     <---------ARR14(2)         --------->ARR14(2)
                        <---------ARR11(3)               <---------ARR11(3)        --------->KAN1
                        ------->TEIL<------MYB83         --------->ARR11(3)        <---------KAN1
------->RAV1(1)        <---------CCA1(2)--------->KAN1  <---------CCA1(2)     ------>ZmHOX2a(1)  ---
 
cacagtagttcccattctaatccactgtatcttatcagttggtatcttcgacgttcttggtatcttcttccctgtatactcctcgagtattctccgaatt  15077600
                                                                           <---------KAN1
                                                                         <---------GLK1(2)      ----
                                                                      --------->HSFB2a(2)       <---
                                                                      <---------HSFB2a(2)       <---
                                                                     <---------LBD16            ----
                                                                    <---------ANAC46--------->ARR14(2)
                                                                 --------->HSFB2a(1)<---------ARR11(2)
     --------->LBD16                                             <---------HSFB2a(1)<---------ARR14(2)
   <---------LBD16                     ---------->DOF2    --------->MYB52(1)        --------->ARR11(2)
----------->HVH21               --------->At4g35610  ----------->HVH21--------->LBD16          -----
---GLK1(1)                   <------ZmHOX2a(2)   <---------ALFIN1<---------KAN1 <---------At4g35610
-->GLK1(1)                  <---------GATA12  --------->REM1(1) <---------KAN4(2)<---------ANAC46
------>TOE1(2)    --------->KAN1<---------At4g35610<---------ANAC55(2)------>ZmHOX2a(1)--------->ANAC46
 
ccttcgaccggagcatcgtcgtaattcgatggatcaactgataaaagcttcaacacatgaccatcggaatgtcctggaatctcagcgtatacatcagtga  15077700
         --------->RVE1(2)  <----------DOF2
        <---------CCA1(2)  <---------ANAC58
      ------>ZmHOX2a(1)    <---------ANAC58
------->TEIL          --------->TOE2(3)
----------->AtSPL3  --------->GLK1(2)                                         ------->GAMYB<--------
------------AtSPL8  --------->ARR11(3)                                    --------->MYB46(3) <------
------------AtSPL3  <---------ARR11(3)                                  ------>MYB83       ---------
----------->AtSPL8  <-----------ARR10                                   ------>MYB46(1)--------->ANAC46
----->DOF2          --------->RVE1(2)                             <---------KAN1     --------->ZAT6
 
aagtacctcctctatctatacaaaatcttagctttccttcgattacagttcccatctcactctctctgcataacccaacaacgaaattacactaaattac  15077800
                                                                                                 <--
                                                                                               <----
                                                                                               <----
                                                                                              ------
                                                             --------->TOE1(2)                <-----
                          --------->MYB52(1)        <---------AHL20(3)                        <-----
                       --------->YAB1               <---------AHL20(2)                        <-----
                       --------->YAB5               --------->AHL25(1)                        ------
                      <------ZmHOX2a(2)             <---------AHL25(1)                  --------->RVE1(2)
-WOX13(2)            <---------ARR11(3)             --------->AHL20(3)              --------->YAB1
-----GT1             --------->ARR11(3) <---------RVE1(2)  ------->TEIL            <---------YAB5<--
>WOX13(2)  --------->ARR11(3)------->GAMYB          --------->AHL20(2) --------->DOF5.7(1)  --------
 
caattcacaacaacgatattgagagatcataacagcaattttagatagtatcgattaaaatgaaactacgagagaaggggtttgtaatcaaaatccagat  15077900
                                         ------>ZmHOX2a(2)
                                       <---------GATA12
          <---------ANAC58   <------ZmHOX2a(2)
          <---------ANAC58   ================HOX2a_HOX2a
    <---------------AtSPL8  <---------ARR14(2)
   ---------->DOF2          <---------ARR11(3)                                 --------->YAB5
 <---------YAB1             --------->ARR11(3)                          <------MYB83
-------AHL12(2)             --------->GATA12                            <------MYB46(1)
-----RVE1(1)                --------->ARR14(2)                         --------->MYB55(2)
-----CCA1(1)              ----------->ARR10                            <---------MYB46(3)
--->ARR11(3)           <---------ANAC46<---------ARR11(2)             <---------ANAC46
----ARR14(2)          <------NtERF2    <---------ARR14(2)           <---------ANAC46
----RVE1(2)      <---------AtMYB61     --------->ARR11(2)         --------->REM1(2)
----ARR11(3)  <---------ANAC58 <-------GAMYB                      --------->ZAT14
--->ARR14(2)  <---------ANAC58------>ZmHOX2a(2)                   <---------ZAT14                  -
-------AHL20(3)<----------DOF2===============HOX2a_HOX2a   <---------WRKY38(1) --------->YAB1  <----
->LBD16 ------->TEIL<---------DEAR3(1)<------ZmHOX2a(1)    <---------WRKY12   --------->ICU4 -------
 
atttatgaaagtaccttgctttggtggcgaagatcgttgaaggatcgagttttagcgaagagtcaacagtgtagtgggtgaatgatgaagaagatgaatc  15078000
                                     <---------DAG2
                                     <----------DOF2
                                    <---------ANAC58
                              <---------DOF5.7(1)
                           ------>ZmHOX2a(2)
                          <------ZmHOX2a(2)
                         <-----------ARR10
                         <---------ARR14(3)
                         <---------ARR11(2)                                                       --
                         --------->GATA12                                                         --
                         <---------GATA12                                 <-------GAMYB          <--
         --------->YAB5  <---------RVE1(2)                               <------MYB83            <--
        --------->ICU4   --------->ARR14(3)                              --------->MYB52(2)    -----
        <---------YAB1   --------->ARR11(3)                              <---------MYB46(3)   <-----
      --------->YAB5     <---------ARR14(2)                              <------MYB46(1)    <-------
      *TSS <---------YAB1--------->ARR11(2)                              --------->MYB55(2)<--------
      --------->YAB1     --------->ARR14(2)                              ----------->GT1   ---------
     <---------YAB1      <---------ARR11(3)--------->LBD16             <--------P          ---------
-------->ALFIN1  <---------KAN1<----------DOF2  <-----------GT1       <-------GAMYB        <--------
-------RAV1(2)  --------->GLK1(2)   <---------ANAC58                 <---------MYB46(3)  -----------
>TEIL--------->ICU4     <------ZmHOX2a(1)<---------LBD16        <----------DOF2   --------->AHL20(2)
 
aggtggtgatgatgatgagaatgtgaaggatcttcttttgcttttccggttttactaaaccatttcggtttttggttggttagaatttaaaacggatata  15078100
                                                                      --------->KAN4(2)
                                                                     --------->KAN4(1)
                                                                     <---------GLK1(1)
                                                                     --------->GLK1(1)
                                                                     <---------KAN4(1)
                                                                     --------->KAN1
                                                                     <---------KAN1
                                                                     <----------TaMYB80
                                                                     <---------HSFB2a(1)
                                                                     --------->HSFB2a(1)
                                                                    <---------KAN4(2)
                                                                    --------->ARR11(3)
                                                                    ---------->TaMYB80
                                                                    <---------RVE1(2)           <---
                                                                    <---------ARR11(3)         <----
                                                                    --------->ARR14(2)      --------
       <---------ALFIN1                                             --------->ARR11(2)     ---------
------->YAB5                                                        <---------ARR14(2)     ---------
------->YAB1                                                    <---------LBD16            <--------
-------YAB5                                                     ------>ZmHOX2a(2)          -------->ATHB1
-------YAB1                                                    <------ZmHOX2a(2)           <--------HAHB4
---->YAB1               --------->ALFIN1                      <---------GATA12            <---------AHL12(1)
----AHL20(2)            <-----------RAV1(1)                   --------->GATA12 <---------YAB1<------
--KAN1 --------->MYB52(1)                                     --------->ARR14(2)          <---------YAB5
-ARR14(2)     <---------YAB1                                  <---------ARR14(2)          --------->AHL25(3)
>ARR14(2)--------->ANAC58                                     <---------ARR11(2)          <---------KAN1
>ARR11(2)--------->ANAC46                                     --------->ARR11(2)          --------->ICU4
-ARR11(2)--------->ANAC58      <---------MYB59            ----------------->AGL1    --------->MYB52(1)
>GT1--------->ANAC46 ------->TEIL                         <---------LBD16  <---------RVE1(2)<-------
 
atcataaaccccacggtatgaatgaatgtgttggcctaatttgtgtaatgttatctactggaccggatcgggatattcgattttgaataacgaattatta  15078200
                                                             <---------RVE1(2)
                                                      <---------AHL25(3)
                                                      <---------AHL12(1)
                                                      --------->AHL12(1)
                                                      --------->AHL25(3)
                                                      --------->AHL20(2)
                                      <-----------GT1 <---------AHL20(2)
                                   <---------WOX13(2) <---------YAB1
                                   --------->WOX13(2) --------->AHL12(3)
                                   --------->AHL12(2) <---------AHL12(3)
                                   <---------AHL12(2) <---------AHL25(1)
                           <---------AHL25(3)         --------->AHL25(1)
                          --------->AHL25(2)         --------->AHL20(3)
                          <---------AHL12(1)         <---------AHL25(1)
                          <---------AHL25(1)         <---------AHL20(3)
                          --------->AHL12(1)         <---------AHL20(2)
                          --------->AHL20(1)         <---------AHL20(1)
                          --------->AHL25(1)         --------->AHL20(1)
                          <---------AHL25(3)         --------->AHL20(2)
                          --------->AHL20(2)         --------->AHL25(3)
                          <---------AHL20(2)         --------->AHL25(2)
                          --------->AHL25(3)         <---------AHL25(2)
                          <---------AHL25(2)       <---------YAB1
                          <---------AHL20(1)      --------->AHL20(3)
                         --------->AHL12(3)       <---------AHL12(3)
                         <---------AHL12(3)       <---------AHL25(3)
                         <---------AHL25(2)       <---------AHL20(3)
                         --------->AHL12(2)       --------->AHL12(3)
                        <---------AHL12(2)        --------->AHL20(2)
                        --------->AHL12(2)        --------->AHL25(2)
                       --------->AHL20(3)        --------->AHL25(1)
                       <---------AHL12(3)        <---------AHL12(1)
                       <---------AHL20(3)        <---------AHL20(2)
                       <---------AHL20(2)        --------->AHL12(1)                                -
                       --------->AHL12(3)        --------->AHL20(2)                                -
                      --------->AHL25(3)         <---------AHL25(3)                                <
                     <---------AHL12(3)          <---------AHL25(1)                     --------->YAB1
                     <---------AHL20(2)        <---------WOX13(2)                      <---------YAB1
------TOE2(3)        --------->AHL25(1)        --------->WOX13(2)                     --------->RVE1(2)
-------GT1           --------->AHL12(3)        --------->AHL12(2)                     --------->ARR11(3)
->AHL12(2)           --------->AHL20(2)      <---------AHL20(2)                 ------>ZmHOX2a(1)  <
>YAB5                --------->AHL25(3)      --------->AHL20(2)--------->AHL20(2)     <---------ARR11(3)
>ATHB51              <---------AHL25(1)  <----------DOF2--------->WOX13(2)<---------GATA12         -
-ICU4 --------->ANAC46<---------AHL25(3) <---------DAG2--------->YAB5    <---------GLK1(1)   -------
---YAB1  ----------->RAV1(1)      <---------AHL20(2)--------->YAB1  --------->YAB5 --------->YAB1  -
--AHL12(2)       --------------->AGL15<---------AHL20(2)<---------WOX13(2)--------->GATA12   <------
 
acattttagaggccacatttctatataaatttattgtttatttactttttaattaatataattagattatatgatgaaatctcctataatatcatacttt  15078300
      --------->TOE2(3)
 <---------AHL25(3)
 <---------AHL20(2)
 --------->AHL20(2)
 --------->AHL12(3)
 <---------AHL12(3)
 --------->AHL25(2)
 <---------AHL25(1)
 --------->AHL25(1)
 --------->AHL12(1)
 --------->ATHB51
 <---------ICU4
 <---------AHL12(1)
--------->AHL25(2)
<---------AHL25(1)
--------->AHL12(3)
--------->AHL25(1)
--------->AHL12(1)
<---------AHL20(2)
<---------AHL25(2)                --------->ANAC46
<---------AHL12(3)                <---------ANAC55(2)
<---------AHL12(1)                --------->ANAC55(2)
--------->AHL25(3)                --------->ANAC58
-------->AHL12(2)                 --------->ANAC58
-------->AHL25(2)               <-----------GT1                                          <---------ANAC55(1)
---------AHL20(3)       <---------ARR11(2)                                               --------->ANAC55(2)
---------AHL25(2)       <-----------GT1                                                <-----------GT1
-------->AHL12(3)       --------->ARR11(2)                                     --------->AHL12(2)
-->TOE2(3)              --------->RVE1(2)                                    <---------DOF5.7(1)
-------->AHL20(3)      <---------CCA1(2)       <-------TEIL  ------->TEIL   <---------MYB52(1)  ----
----DOF2           <---------ANAC46     <----------DOF2 <---------KAN1--------->DOF5.7(1)<---------ANAC55(2)
 
aaaattatttcttaaaacagatgtgtatatccatattacgaaactttacatacatactaatatgcacataagaaaaatcgtttttttttgttacatgttg  15078400
                                                                                             <------
                                                                                             <------
                                                                                            --------
                                                                                            --------
                                                                                            <-------
                                                                                            <-------
                                                                                            <-------
                                                                                            --------
                                <---------ICU4                                              --------
                                --------->ATHB12                                            --------
                               <---------YAB5                                               <-------
                               <---------YAB1                                               <-------
                               --------->ICU4                                               --------
                             --------->YAB1                                                 <-------
                            <---------YAB1                                                 ---------
                           --------->AHL20(1)                                              <--------
                           --------->AHL20(2)                                              <--------
                           <---------AHL25(2)                                        ----------->GT1
                           --------->AHL25(2)                                        <---------ANAC55(2)
                           <---------AHL20(3)                                        <---------WOX13(2)
                           <---------AHL20(2)                                        --------->ANAC55(2)
                           --------->AHL20(3)                                   <---------ZAT6
                          --------->YAB1                                      <---------ANAC46
          ----------->GT1 <---------ICU4                                      <---------ANAC58
      --------->AHL20(3) --------->ICU4                                 <---------AHL20(2) ---------
      <---------AHL25(1) <---------YAB5                                 --------->AHL20(2) <--------
      <---------AHL20(3) <---------YAB1                                 --------->AHL12(1) ---------
      <---------AHL20(2)--------->WOX13(2)          --------->YAB1      <---------AHL25(2) <--------
     --------->AHL20(2) <---------WOX13(2)     --------->AHL20(2)       <---------AHL12(1) ---------
     --------->AHL25(3)<---------ICU4         <---------AHL20(2)        --------->AHL25(2) <--------
------->GT1            --------->YAB1  --------->HSFB2a(2) ----------->GT1    <---------ANAC58
 
ggaaaatataaaattgtaaaatacactaattataatgattttctagtattttaaatcatattttgttaaaaccaaaaaattgagtgttaagtaaaaaaat  15078500
<- Previous    Next ->

AGI:  At5g37830.1   
Description:  OXP1 (OXOPROLINASE 1); hydrolase. similar to hypothetical protein OsI_005203 [Oryza sativa (indica cultivar-group)] (GB:EAY77356.1); similar to putative 5-oxoprolinase [Oryza sativa (japonica cultivar-group)] (GB:BAC05619.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO15624.1); contains InterPro domain Hydantoinaseoxoprolinase, N-terminal (InterPro:IPR008040); contains InterPro domain Hydantoinase B/oxoprolinase; (InterPro:IPR003692); contains InterPro domain Hydantoinase/oxoprolinase; (InterPro:IPR002821)
Range:  from: 15073418    to: 15078007    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version