AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
       <------MYB46(1)
       <------MYB83
 ------>ZmHOX2a(1)
--------->TOE2(3)
<---------------AGL15
--------------->AGL15
---------------->AGL3
-----------------AGL2
-----------------AGL3
---------------->AGL2
-----------------AG
-----------------AGL1
---------------->AGL1
---------------->AG                                                                                <
-------->ID1                                                                                       <
-----DAG2                                                        ---------->DOF2                 <--
------DOF2                        <-----------GT1              <---------HSFB2a(2)         ---------
----ANAC58                       <-----------GT1               --------->HSFB2a(2)     --------->MYB59
----ANAC58                    --------->YAB5                   ------>ZmHOX2a(1)       <---------TOE2(3)
-RAV1(1)                  <---------ARR11(3)          <-----------GT1                  <---------TOE1(3)
 
tttccttatttggtttgggcctagcccaagaactgtttaccctccctccaatccatttttcaagtcctcgaagcccatgaacagtttttttaggttaagc  13950900
                        <----------DOF2
                     <---------ARR11(3)
                     --------->ARR11(3)
                    <------MYB83
              <---------TOE1(2)
              <---------TOE2(2)<-----------GT1
--------->ARR11(3)  <------MYB46(1)
--------->GATA12   --------->MYB46(2)
<---------GATA12   <---------AtMYB61
<---------ARR11(3) --------->MYB59                                                         ---------
---------CCA1(2) <--------P  <-----------GT1                                        -------->P   ---
---------ALFIN1 <-----------HVH21                                     <----------DOF2   ------>MYB83
-------ALFIN1<-----------RAV1(2) --------->ZAT6              <----------DOF2     --------->At4g35610
->DOF2 <xxxxxxxxxxxxxxxxxxxxsmallRNA(se3)             <---------YAB1 <---------DOF5.7(1)------>MYB46(1)
 
ccacatcttgtttggcccaggttaggtctttatttcactctagcaaacccaaacgttttgatttctttctcgtctttggagagtagctaccttccgagat  13951000
                                                                                <---------ARR14(2)
                                                                                --------->GLK1(2)
                                                                                <---------GATA12
                                                                                <-----------ARR10
                                                                       <---------TOE2(3)
                                                                 <------MYB46(1)--------->RVE1(2)
                                                                 <---------MYB46(3)
                                                                 <------MYB83   --------->GATA12 <--
                                                                <---------TOE1(2)            -------
             --------->ATHB12                                   <---------TOE2(2)      ------>ZmHOX2a(2)
        <---------YAB1   <<<<<<<<<MYB2       ----------->GT1   <---------MYB52(1)    <---------GATA12
  <---------YAB1 <------MYB83         ---------->DOF2         <-------GAMYB<-----------GT1  --------
>LBD16  <---------YAB5<---------AtMYB61     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)    --------->GATA12
------>MYB52(2)  <------MYB46(1)   ----------->RAV1(1)    <---------At4g35610   --------->ARR14(2)
 
tagttgtgatggtcattgtttggttttggttttctctcccacaaagtttggcaaataggttagctcgttggttttatgttacaaatctgatctcaaaaag  13951100
                                                          <---------YAB1
                                                   <------------CBF              ---------->DOF2
                                                <---------ANAC55(2)    --------->YAB1           <---
                                                --------->ANAC55(2)  <---------WOX13(2)   <---------
--------DOF2 <---------DAG2                     <---------ANAC55(1)  --------->WOX13(2)   <---------DOF5.7(1)
-->DAG2      <----------DOF2                   ------>ZmHOX2a(2)    --------->WOX13(1)   <---------DOF5.7(1)
-->DOF2   <---------ALFIN1                 <---------ATHB12       ------------>CBF    <---------ZAT18
 
ctttgggctaactccacttttgaagtgttttagagtcttgatgcccatgatccgtattgttatgtttctgtcaattacaacccctatagcaccctttaac  13951200
                      --------->ANAC58
              --------->ZAT18
              <---------ZAT18
              --------->WRKY38(1)
           <---------ANAC46       --------->MYB52(1)
         ----------------------->TaNAC69(2)
        <------MYB46(1)           <-----------GT1                                     --------->AHL12(2)
        <------MYB83<---------ALFIN1<------------MYB.PH3(1)  <---------GLK1(2)        <---------WOX13(2)
       <---------MYB46(3) --------->MYB52(1)                 <---------RVE1(2)        --------->WOX13(2)
      <---------ANAC58--------->ANAC46        <---------TOE2(3)  <----------DOF2      <---------AHL12(2)
-------DOF2<---------MYB46(3)    <---------KAN1        <---------YAB1      <-----------HVH21  ------
-DOF2 <---------ANAC58--------->ANAC58    <----------DOF2 <---------WOX13(1)     ----------->GT1 xxx
 
tttgttttggctggtcgtggactccacgctaacagagtaacagttcttttaggctgttttgatagatacttttgtcgaggtcatttgttaattttgtttc  13951300
                                                                                         <---------ARR11(2)
                                                                                        <-------GAMYB
                                                                                       <---------MYB46(3)
                                                                                       --------->MYB55(2)
                                                                    ------>ZmHOX2a(2) --------->ALFIN1
                                                                <---------YAB5        <---------AtMYB61
                                                        --------->ANAC58           <---------DEAR3(1)
                                                   >>>>>>>>>TBF1<---------YAB1     --------->ALFIN1
                                          --------->DOF5.7(1) <---------ICU4  --------->ANAC46   <--
                                     ----------------->AGL1  --------->ICU4  <---------LBD16     <--
               --------->YAB1      --------->RVE1(2)    --------->ANAC46   <---------REM1(2)     ---
--------->AtSPL8      <---------ALFIN1  ---------->DOF2 --------->ANAC58 --------->RVE1(2)       ---
xxxxxxxxxxxxx>smallRNA(i)     ------------>CBF <---------ZAT14--------->YAB1<---------ALFIN1<-------
 
gaaccctatttgagactatcatcccaaacctttggcaatgtccaaaagagtgaagaagaacgccattatgatcccatctccacggagcggtggttaccga  13951400
                                                                             <---------GATA12
                                    ------>MYB46(1)                          --------->GATA12
                                    --------->ANAC58                         --------->RVE1(2)
                             <---------WOX13(2)                    <---------KAN1
                             --------->WOX13(2)                   --------->ARR11(2)
                            --------->WOX13(1)                <---------LBD16--------->GLK1(2)
                         --------->LBD16                    <---------ARR11(2)
                         ------>NtERF2            <---------ARR14(2)         --------->ARR14(2)
                        --------->ANAC46          --------->ARR14(2)         <---------ARR11(2)
                        --------->ANAC58          <---------ARR11(3)         <---------ARR14(2)
                        --------->ANAC58          --------->ARR11(2)        <---------GLK1(1)   ----
-------HSFB2a(1)       <---------LBD16        <---------TOE2(3)   <---------ARR11(2)    <---------ANAC58
-------HSFC1(2)        --------->MYB46(3) ------>ZmHOX2a(1) --------->ARR11(2)          <---------ANAC58
------>HSFB2a(1)     -------->P     --------->ANAC58        <---------ARR14(2)      ---------->DOF2
------>HSFC1(2)    ------>ZmHOX2a(1)------>MYB83  --------->ARR11(3)        <---------CCA1(2) ------
--HSFB2a(2)       <---------DOF5.7(1)<---------ZAT2         --------->ARR14(2)    ----------->HVH21
 
agcttcttcaactctctacctccttacccgccaattaccaagctccttcaaggtatcttcaagtatacggataagttgcaaatctgtgaaagcttggcaa  13951500
                                                                                             <------
              -------->P                                                                     <------MYB46(1)
             <-----------GT1                                                                 <------MYB83
            ------>ZmHOX2a(2)                                                               <-------
          --------->GATA12                                                                 <--------
          --------->ARR11(3)                                                              ------->MYC3
          <---------ARR11(3)             <---------DOF5.7(1)                              <-------MYC3
        <---------YAB1                   <----------DOF2                                 --------->TGA1a
        <---------YAB5          --------->ALFIN1                                         <---------O2
    <----------DOF2            --------->LBD16                                           <---------TGA1a
   <---------ANAC46           <---------O2                                               --------->O2
  <------NtERF2   <----------DOF2       <---------DAG2                                 <---------ALFIN1
<---------DEAR3(1)<---------DOF5.7(1)   <---------DOF5.7(1)                  <---------MYB52(1)
----->DOF5.7(1)  <---------DOF5.7(1) <---------ALFIN1           <---------ANAC58     --------->AtMYB61
---->DOF2 <-----------ARR10   <---------ANAC46      <-------TEIL<---------ANAC58  <-----------GT1
 
agagcggcgttatgatctaccctttattttctcccgtggagcaccttttcaaaggctcatatgcattgtttgcaatagccgtttatgaccacacgttggt  13951600
                                         --------->TOE2(3)
                                    <xxxxxxxxxxxxxxxxsmallRNA(i)
      <---------HSFB2a(2)           ---------->DOF2
      --------->HSFB2a(2)        ------>NtERF2
     <---------ANAC46            --------->LBD16
  --------->GLK1(1)             --------->ANAC46
  <---------GLK1(1)           <---------KAN1----------->RAV1(1)                           <---------
  <---------KAN1             <---------ARR14(2)                                          <---------DOF5.7(1)
 <---------ARR14(2)          --------->ARR11(2)                                  --------->ZAT18
 --------->ARR14(2)          --------->GATA12        <-----------GT1             <---------ZAT18
<------ZmHOX2a(1)            <---------GATA12    --------->ARR11(3)              --------->ZAT14
---MYB46(3)                  --------->ARR14(2)  <---------RVE1(2)          ---------->DOF2
--AtMYB61                    <---------ARR11(2)  <---------GLK1(2)   <----------DOF2     xxxxxxxxxxx
-MYB52(1)             XXXXXXXXXXXXXXXXXXXX>MIR842<---------ARR11(3)  <---------DAG2 <---------ALFIN1
 
cgaggatttcgcgaagcccgtcttcatggtcgaatccgccaaagcctcaacagatttttcaaaccttgtaaacttttttaaaagtgaacacctctttgca  13951700
                                                                                        --------->ATHB51
                                                                                        <---------ICU4
                                                                                        <---------AHL25(3)
                                                                                        --------->ATHB12
                                                                                        -------->ATHB1
                                                                                       <---------ATHB51
                                                                                       <---------AHL12(1)
                                                                                       --------->ICU4
                                                                                       <---------YAB1
                                                                                       --------->AHL25(3)
                                                                                       --------->AHL12(1)
                                                                                       --------->AHL20(1)
                                                                                       <---------AHL20(2)
                                                                                       <---------AHL25(2)
                                                                                       <---------AHL25(1)
                                                                                       --------->AHL25(2)
                                                              <---------DOF5.7(1)     --------->AHL25(2)
                         --------------->AtSPL8              <----------DOF2          <---------AHL20(3)
                        <---------ANAC58                     <---------DOF5.7(1)      --------->AHL20(3)
                        <---------ANAC46                     <---------DAG2           <---------AHL25(2)
               --------->YAB1     --------->TOE2(3)         <---------DOF5.7(1)       --------->AHL12(2)
-DOF2       <---------CCA1(2)     --------->YAB1      ------->TEIL                    <---------AHL12(2)
xxxxx>smallRNA(i)       <---------ANAC58         <---------AtLEC2                 --------->YAB1
 
aaactcatgaagcctctatcttcattttcttgtactatcttagttctaatttgtatgaacttccctttttttaggcttaagtgaatgaaaattattgttt  13951800
<- Previous    Next ->

AGI:  At5g35760.1   
Description:  beta-galactosidase. similar to beta-galactosidase [Arabidopsis thaliana] (TAIR:AT5G01080.1); contains InterPro domain Glycoside hydrolase, family 35; (InterPro:IPR001944)
Range:  from: 13951338    to: 13952012    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version