AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                      --------->RVE1(2)
                                                      <---------ARR14(2)
                                               --------->TGA2(2)
                                              <-----------HVH21
                                              <-----------TGA1
                                             <---------bZIP60(1)
                                             --------->ANAC46
                                             --------->TGA1a
                                             <---------O2
                                             --------->O2                                         <-
                                             --------->bZIP60(2)                                 <--
                                             --------->ANAC58                                    ---
                                             --------->ANAC55(2)                                 ---
                                             --------->ANAC58                                    <--
                                             <---------ANAC55(2)                                 ---
                                             --------->bZIP60(1)                                 ---
                                             <---------TGA1a                                     <--
                                             ===================================================bZIP_DOF
                                    --------->ATHB12  <-----------ARR10                          <--
                                    --------->YAB5    --------->GATA12                           ---
                                    -------->HAHB4    <---------GATA12                           ---
                                   <---------ATHB12  ------>MYB46(1)                            <---
                                 ------>MYB46(1)     ------>MYB83                         --------->GLK1(2)
                                 ------>MYB83--------->TGA2(1)                       ---------->DOF2
                         <---------KAN1<-------TEIL  <---------CCA1(2)            ----------->RAV1(1)
       <---------At4g35610  <-----------GT1  --------->ANAC55(1)          ====================RAV<--
       --------->At4g35610--------->RVE1(2) <-----------STF1              ----------->RAV1(2)   <---
-------->YAB1          <---------GLK1(2)--------->YAB1--------->ARR14(2)<-----------GT1  <---------GLK1(2)
 
aacaatactgagctcaagaacacagagattatcaccaaatgattcatcacgtcaccaaatctcgactcagtttttttacctgtagccacaaagaatcgcg  13128500
                                                                          ------>ZmHOX2a(2)
     --------->YAB5                                                      <------ZmHOX2a(2)
--------KAN1                              <-------TEIL                   --------->CCA1(2)
-------ARR11(1)                 --------->RVE1(2)                       <---------ARR11(3)
------>GLK1(2)                  --------->GATA12                        --------->ARR11(3)
------>ARR11(2)                 <---------GATA12                        --------->AGP1
-------ARR11(2)                 <---------ARR14(2)                      <---------AGP1
------>RVE1(2)                  --------->ARR14(2)                      <---------GATA12
------>ARR14(2)                 --------->ARR11(3)                      <---------RVE1(2)
---------ARR10                  --------->GLK1(2)                       --------->RVE1(2)
-------ARR14(2)                <---------ARR14(1)                       <---------ARR14(2)
------>GATA12                  <---------CCA1(2)                <---------RVE1(2)                 <-
---->TEIL               <---------KAN1   --------->CCA1(2)    <---------YAB1                      <-
------CCA1(2)   <---------GATA12<-----------ARR10             <---------YAB5                   <----
-------GATA12   --------->RVE1(2) --------->TOE2(3)     <-------TEIL    --------->ARR14(2)     <----
------ARR14(1)  --------->GATA12<---------ARR11(3)   --------->KAN1     --------->GATA12       -----
 
aatctgaatgttgatttcaaatctagaatgaagcaaatcttaagatacaatctgagaaattcgttgtgattttaagatctgaagaaatcgagagagaggt  13128600
        --------->TOE1(2)
        --------->TOE2(2)
       <---------ANAC55(2)                                               <---------KAN1
       ----------->RAV1(2)                                               --------->GLK1(1)
     <-----------GT1     ----------->HVH21                              <---------RVE1(2)
 <---------RVE1(2)     <---------At4g35610                              --------->ARR14(2)
--------TOE1(3)        --------->At4g35610                              <---------ARR14(2)
--------TOE2(3)      <------ZmHOX2a(1)                     --------->WOX13(2)  <---------YAB1
-----ARR14(2)   <---------REM1(1)                         --------->YAB1<---------ARR11(2)
-----ARR11(2) --------->CCA1(2)                --------->HSFB2a(2)      --------->ARR11(2)       ---
---->ARR14(2) --------->At4g35610              <---------HSFB2a(2) <-----------HVH21  --------->At4g35610
 
tatggatattacctgagagatgaaggagatgacatttgggagattatcgtctcgatgacattaataagcccgtcggatatgtatgaatgagctatcgaag  13128700
                                <---------ANAC46
                            <---------ANAC58
                         <---------WOX13(1)
                       --------->ATHB12                                           <---------WOX13(2)
                      <---------YAB5                                     --------->ARR11(2)
                 --------->GATA12                                        <---------ARR11(2)
            --------->ALFIN1<---------ANAC58                          <---------ANAC55(2)
          <---------ANAC58 <------MYB83                               --------->ANAC55(2)
          <---------ANAC58 <------MYB46(1)                      <-------TEIL      --------->WOX13(2)
          <---------ANAC46 <---------MYB46(3)                   --------->ZAT18  <-----------GT1----
         <-------TEIL <---------YAB1                  <---------YAB5--------->MYB52(1)      --------
------>DOF5.7(1) <---------GATA12         <---------RVE1(2)---------->DOF2  <---------DAG2 <--------
 
aaggtgaccacatacgtggagatttatgattggttgagggaaatggattgggtcttaagcattaaagtgcataacgtaaccttttaactaatttgatatt  13128800
                     ---------->DOF2
                 --------->ANAC58                                                               ----
          <------MYB46(1)                                                                     ------
          <------MYB83--------->DAG2                                                          ------
          <---------ANAC58                                                                    <-----
          <---------ANAC58                                                            ---------->DOF2
         --------->MYB46(2)                 --------->ANAC58                       --------->ANAC58
----->TOE2(3)    --------->ANAC58           --------->ANAC46 --------->DAG2        --------->ANAC46
->KAN1   <---------AtMYB61                  --------->ANAC58---------->DOF2        --------->ANAC58
-RVE1(2) --------->MYB111(2)               --------->LBD16  *TSS                --------->ANAC46<---
 
cttagaaatagtttggtgtcaagaaaaagtttggactcaagacttccacgatatcgctggagaaaaagtttctaagagcatctacgacgcaaagttttta  13128900
                                 <-----------TBP
                                 <---------AHL20(2)
                                 --------->AHL12(3)
                             <-----------TBP
                             --------->AHL20(2)
                             <---------AHL20(2)
                             <---------AHL12(3)
                           <-----------TBP
                           --------->AHL20(2)
                           <---------AHL20(2)
                           --------->AHL12(3)
                           <---------AHL12(3)
                         --------->AHL20(2)
                         <-----------TBP
                         <---------AHL20(2)
                         <---------AHL12(3)
                       ----------->TBP
                      <---------AHL20(2)
                 <---------AHL20(1)
                 --------->AHL20(3)
                 <---------AHL20(2)
                 --------->AHL20(2)
                 <---------AHL25(3)
                 --------->AHL20(1)
                 <---------AHL25(2)
                 <---------AHL20(3)
                 --------->AHL25(2)
                 --------->AHL25(1)
                --------->AHL20(2)
                --------->AHL12(1)                                                     ----------->GT1
                --------->YAB1 --------->AHL12(3)                                      --------->LBD16
                <---------AHL12(1)                                                   <---------LBD16
                <---------AHL20(2)                                                --------->KAN1
                <---------AHL25(1)       ---------->DOF2                   --------->YAB1
                --------->AHL12(3) <-----------TBP                        <---------AHL20(2)
                <---------AHL25(3) <---------AHL20(2)                     <---------YAB1
                --------->AHL25(3) --------->AHL20(2)                    --------->AHL25(3)
                <---------AHL12(3) <---------AHL12(3)                    <---------AHL25(3)
                --------->AHL25(1) --------->AHL12(3)                    --------->AHL20(1)
               <---------YAB5--------->AHL12(3)                          --------->AHL20(2)
            <---------AHL25(1) --------->AHL20(2)                        <---------AHL20(3)
        <---------TOE2(3)--------->AHL12(3)                              <---------AHL20(1)
 <---------RVE1(2)   --------->AHL20(2)<---------AHL20(2)                --------->AHL25(2)
----->WOX13(2)<---------WOX13(2) <---------AHL12(3)                      <---------AHL25(2)
--->AHL25(3)--------->AHL25(1) <---------AHL12(3)    --------->YAB1      --------->AHL25(1)       --
--->AHL20(2)<---------AHL20(2) <---------AHL20(2) --------->CCA1(2)      --------->AHL20(3) --------
----AHL20(2)--------->AHL20(2) <-----------TBP  <------ZmHOX2a(1)     --------->AHL20(3)    <-------
------WOX13(2)--------->WOX13(2) --------->AHL20(2)--------->AHL20(2) --------->AHL20(2)    <-------
 
atttgatttttaagtttaattatattatatatatatatatatataaaagtaggatataatacttcagtttcaaaaatataatagttcatgcggaaaaata  13129000
                                                  <---------WRKY12
                                                  <---------WRKY38(1)
                                         <----------DOF2
                                    <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
                                    <---------YAB5<---------WRKY45
                                 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
                              <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)
                             --------->DOF5.7(1) --------->WRKY18(1)
                           ---------->DOF2      <--------ZAP1
                     <-----------HVH21 <-----------------AGL1
                    xxxxxxxxxxxxxxxxx>smallRNA(si3)
                   <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
       <---------RVE1(2)<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)                 <-----------GT1
      --------->ATHB12<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)               xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
-------->DOF2    <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)              ---------->DOF2  <---------YAB1
->AHL20(3)      <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)      <---------YAB1 <---------KAN1
--AHL20(3)      <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2) <---------TOE2(3)  <---------GLK1(2)
--AHL12(3) <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)<-----------HVH21   --------->DOF5.7(1)
 
taaaagaattgatttggctatatatgtcaccaaagagtagttatctttttcggtcaaaggttttgattcaaaaaagaatttcacagttatgagtgtttga  13129100
                                  --------->YAB5
                        ------>MYB46(1)    <---------ARR11(2)
                        ------>MYB83<---------WOX13(1)
                      <xxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                  ----------->HVH21xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
                 <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
                 xxxxxxxxxxxxxxxx>smallRNA(s) --------->KAN1
                <---------ANAC58  -------->HAHB4
                xxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
                xxxxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                <---------ANAC58  --------->ATHB12             --------->ANAC58
               <---------MYB46(3)--------->ICU4                --------->ANAC58
              xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)            --------->DAG2
            xxxxxxxxxxxxxxxxxxxxxx>smallRNA(s2)       xxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
            xxxxxxxxxxxxxxxx>smallRNA(s)   xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
            xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)  <---------ANAC58
            --------->ATHB12     <---------YAB1   <---------ANAC58
           <---------YAB1        <---------ATHB12xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
        xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
    ----------->GT1xxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)     <---------KAN1         ----------->GT1
    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)  --------->ARR11(2)---------->DOF2<---------ARR11(3)   ===
   xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)  <xxxxxxxxxxxxxxxxsmallRNA(s)      --------->ARR11(3)   ---
 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)xxxxxxxxxxxxxxxxxxxx>smallRNA(l2)     --------->CCA1(1)  <-----
 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)  --------->ETT(1)  <------ZmHOX2a(1)--------->RVE1(1)  ======
 
actggaatagttttatgatgggtgaccttccgataaatgattgtcggaactatgcgagtgaggataaagcaagagaaaatatcatgtggtaacaagtctt  13129200
                     --------->MYB55(1)                               --------------->AGL15
                    --------->MYB46(3)                               ----------------->AGL2
                    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)            =================HOX2a_HOX2a
               <---------ANAC58                                      <-----------------AGL3
               xxxxxxxxxxxxxxxx>smallRNA(i)                          ------>ZmHOX2a(2)      <-------GAMYB
               <---------ANAC58                                      ----------------->AGL3 --------
           ------->PIF5--------->DEAR3(2)                           <------ZmHOX2a(2)      <--------
           <-------PIF5--------->SPL7(1)<---------At4g35610        <---------ARR11(2)      ---------
          <---------O2------>MYB46(1) --------->ZAT18              <---------ARR14(2)      <--------
          <---------KAN1              <---------ZAT18              --------->ARR14(2)     ------>NtERF2
          --------->O2------>MYB83   <---------ANAC58              <---------GATA12     <------NtERF2
          <---------ANAC58           <---------ANAC58              --------->RVE1(2)  --------->ETT(1)
          <---------bZIP60(2)       xxxxxxxxxxxxxxxx>smallRNA(i)   --------->ARR11(2) <---------MYB46(3)
          <---------ANAC58         <---------ANAC58                --------->GATA12  --------->ALFIN1
          <---------TGA1a          <---------ANAC58               <------ZmHOX2a(1) <-----------HVH21
       ----------->HVH21          xxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)<---------------AGL15<--------
      --------->TOE1(1)--------->MYB46(3)                       <---------TOE1(2) <---------HSFC1(2)
     <---------HSFB2a(2)        <xxxxxxxxxxxxxxxxsmallRNA(i)    <---------TOE2(2) --------->HSFB2a(1)
     --------->HSFB2a(2)       <-----------RAV1(2)            --------->TOE1(2)   <---------HSFB2a(1)
 <---------GLK1(2) --------->DEAR3(2)--------->ALFIN1         <---------SPL7(1)<------ZmHOX2a(1)<---
====================bZIP_DOF----------->HVH21              =================HOX2a_HOX2a<---------DEAR3(2)
------->DOF2  <xxxxxxxxxxxxxxxxsmallRNA(s)                 <------ZmHOX2a(1)  <xxxxxxxxxxxxxxxxsmallRNA(s)
-----DOF2 --------->TGA1a<-----------HVH21                 ================HOX2a_HOX2a<---------DEAR3(1)
====================bZIP_DOF<---------SPL7(1)    <---------At4g35610==================HOX2a_HOX2a
 
taaagcttctcggacgtggcataccgaccgtcggacaggggtgtgctcatggggctgagagaggacgtaggatccacatataggaacggtcggggcgtta  13129300
                                                                                            <-------
                                                                                            --------
                                                                                            <-------
                                                                                          <---------AHL20(3)
                                                                                          --------->AHL25(1)
                                                                                          --------->AHL20(2)
                                                                                          --------->AHL20(3)
                                                                                          <---------AHL25(1)
                                                                                          <---------AHL12(3)
                                                                                          <---------AHL25(2)
                                                                                          --------->AHL25(2)
                                                                                          <---------AHL12(1)
                                                                                          --------->AHL12(1)
                                                                ---------->DOF2           <---------AHL25(3)
                                                               xxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
                                                               xxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
                                                              <------NtERF2               <---------AHL20(1)
                                                             xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
                                                             xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                                            <---------ATERF1(2)           --------->AHL25(3)
                                                            --------->ATERF1(2)           <---------AHL20(2)
                                                            --------->RAP2.6(2)          <---------AHL12(3)
                                                          <---------ZAT2                 --------->AHL12(3)
                                                          --------->ZAT2                 --------->AHL20(2)
                                                         --------->ANAC58                --------->AHL12(1)
                                                         --------->ANAC58  ----------->GT1--------->AHL20(1)
                                                      --------->ZAT2 --------->CCA1(2)   <---------AHL12(1)
                                                      <---------ZAT2<xxxxxxxxxxxxxxxxsmallRNA(s)<---
                                               --------->DOF5.7(1)  <---------ARR11(3)   <---------AHL20(2)
                                               --------->DAG2<---------RAP2.6(3)     >>>>>>>>>>GT-3b
                                              --------->SPL7(1)xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                              ---------->DOF2--------->LBD16 <---------YAB1<--------
--->GT1                     --------->YAB1 <---------ANAC58--------->RAP2.6(3)    ----------->GT1
-ANAC58                   <---------WOX13(2)<---------SPL7(1)------>NtERF2 --------->YAB1--------->AHL25(1)
-->GT1          --------->AHL20(2)         <---------ANAC58<xxxxxxxxxxxxxxxxsmallRNA(s) <---------AHL12(2)
-ANAC58        <---------DOF5.7(1)  <---------YAB5  <------NtERF2   --------->ARR11(3)  --------->AHL12(2)
-ANAC46       <---------DOF5.7(1)   --------->ICU4  --------->RAP2.3(1)<---------AHL20(2)--------->AHL25(3)
------WOX13(2)<----------DOF2     ----------->GT1   xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)<---------AHL25(1)
 
aatagggcttcactctccttttattagtctattagaatagttattagcgtaaggcgcagcaagccggcaaagatataatggtgataagaaaaataaatta  13129400
<- Previous    Next ->

AGI:  At5g34850.1   
Description:  ATPAP26/PAP26 (purple acid phosphatase 26); acid phosphatase/ protein serine/threonine phosphatase. similar to ATPAP10/PAP10, acid phosphatase/ protein serine/threonine phosphatase [Arabidopsis thaliana] (TAIR:AT2G16430.2); similar to PAP1 (PURPLE ACID PHOSPHATASE 1), acid phosphatase/ protein serine/threonine phosphatase [Arabidopsis thaliana] (TAIR:AT2G27190.1); similar to acid phosphatase [Phaseolus vulgaris] (GB:BAD05166.1); similar to purple acid phosphatase-like protein [Glycine max] (GB:AAN85416.1); similar to acid phosphatase [Lupinus luteus] (GB:CAD30328.1); contains InterPro domain Metallophosphoesterase; (InterPro:IPR004843); conta
Range:  from: 13125384    to: 13128861    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version