AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                          <---------
                                                                                          <---------DOF5.7(1)
                                                                                         <---------DOF5.7(1)
                                                                                       ------>ZmHOX2a(2)
                                                                                      <------ZmHOX2a(2)
                                                                                     --------->ARR11(2)
                                                                                     --------->ARR11(3)
                                                                                     --------->GATA12
                                                                                     <---------ARR11(3)
                                             --------->KAN1                          <---------ARR11(2)
                                             --------->YAB1                          <---------ARR14(2)
                                             --------->YAB5                          <---------GATA12
              <---------MYB52(1)             <---------ICU4                          --------->ARR14(2)
             --------->LBD16                <---------YAB5                          --------->KAN1
             <-----------HVH21              <---------ATHB12                        --------->GLK1(1)
            <---------ANAC58          <-------GAMYB      xxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
            <---------ANAC58         <---------MYB46(3)  --------->ALFIN1           --------->At4g35610
         <---------ARR11(2)         --------->ALFIN1    <------NtERF2               <---------At4g35610
  <---------RVE1(2)                ------->MYC3       <---------DREB2C(2)   <---------MYB46(3)    >>
--------RAV1(1) <---------AtMYB61  <-------MYC3<---------YAB1   <---------ZAT14     <---------GLK1(1)
->HVH21  --------->ARR11(2)       <---------ANAC46    <---------DEAR3(1)   --------->SPL7(1)      >>
 
tgttggattgtgcatccgtgaggtcgaagctaagaccgcgtggttgaatcattcttggcggtgttacttcagagttcggacgttgggagatcccttttgc  11429400
               <---------MYB52(1)
           <------NtERF2
          --------->MYB52(1)
          ------>NtERF2  ----------->HVH21
         --------->DEAR3(1)
         ----------->HVH21                                                                   <------
         --------->RAP2.3(3)                                              <---------ARR11(3)<-------
        --------->DEAR3(2)                                          <----------DOF2         --------
  <-----------HVH21---------->ID1                                  <---------ANAC58      --------->DOF5.7(1)
-DOF2  <---------At4g35610   ---------->DOF2    <-----------HVH21  <---------ANAC58      --------->DAG2
>>>>>>>AtCCA1<---------DEAR3(2)               <xxxxxxxxxxxxxxxxsmallRNA(i)--------->ARR11(3)<-------
>>>>>>>AtLHY <---------MYB46(3)              ------>ZmHOX2a(1)     <---------ANAC46    ---------->DOF2
 
taactcgtcgagccgacggtttgtctctgtgacaaagttggacaggtccttggtcacagttgtgagaatggctttgaggtcttccaaggagaaaggtggt  11429500
                                  --------->WRKY12                                                 -
                                  --------->ZAT18                                                  <
                    --------->ARR14(1)                                                             <
         ------->PIF5             --------->WRKY38(1)                                            ---
      <-----------RAV1(2)    --------->LBD16                                                     <--
 --------->ATHB12  <---------ARR11(2)                                                            <--
 --------->YAB5    --------->GATA12                                                              ---
 <---------ICU4    <---------GLK1(2)                    <---------LBD16                         <---
 --------->YAB1    --------->ARR14(2)                   <---------At5g28300                     ----
<---------YAB5     --------->ARR11(2)                 <---------REM1(2)                         <---
--------->ICU4     <---------ARR14(2)        <---------WRKY12                                   ----
<---------KAN1    ===============================HOX2a_HOX2a             <---------ZAT2         <---
---MYB46(3)       <------ZmHOX2a(1)  <---------WOX13(1)<-----------GT1   --------->ZAT2        <----
--DEAR3(1)       ----------->ARR10<---------ZAT14  <---------MYB52(1)    --------->At4g35610   -----
->ALFIN1<------NtERF2     ------>NtERF2   ------>ZmHOX2a(2)              <---------At4g35610   -----
--AtMYB61<-------PIF5    --------->DEAR3(1)<-----------HVH21    --------->ZAT6            --------->At4g35610
 
ggaatgatggcaggggcgataggattcgcctcccgagttgactgatcgtcaaccgttttcacggctaactctagagagctggaattagatgggagcaaaa  11429600
            <-------TEIL
        <---------TOE2(3)
        <---------TOE1(3)
   ------->TEIL
-------->WOX13(2)
---------TOE2(3)
---------WOX13(2)
------>AHL25(1)
-------AHL20(2)
-------AHL25(3)
------>AHL20(2)
------AHL12(3)            ----------->HVH21                             <---------ARR14(2)
----->AHL20(2)           ------->MYC3                                   --------->TOE1(2)
------AHL25(1)           <-------MYC3                                --------->AHL20(2)
----->AHL25(2)    ---------->DOF2                                  ----------->GT1
------AHL25(2)   --------->AHL20(2)                              ---------->DOF2----------->GT1
-----WOX13(2)  --------->WOX13(2)                              --------->ARR11(3)    <---------WOX13(2)
---->WOX13(2)  <---------WOX13(2)                    --------->RVE1(2)  --------->ARR14(2)       <--
---->AHL12(2) --------->WOX13(1)           ---------->DOF2 ---------->DOF2  <---------HSFB2a(2)  ---
 
ttaatgaacctaaggttcaattaaagcatgtgatgcctattggctcaaaagataactatcccaaaagataaagaaaatacgagaagtaaatgaaaacttt  11429700
                                                                                                 <--
                                                                                               -----
                                                      xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)   ------
                                                    --------->MYB46(3)                   <----------
                 <---------O2                     <-----------GT1                      <---------RVE1(2)
                 --------->O2                     --------->YAB1             <---------ANAC46 <-----
                ------>ZmHOX2a(1)              --------->WOX13(2)     --------->YAB1   --------->ARR11(3)
--------->HSFB2a(2)                       --------->GLK1(1)      *TSS<---------YAB5    <---------ARR11(3)
<---------HSFB2a(2)   <---------YAB1      <---------GLK1(1)   --------->ATHB12        --------->YAB1
-------------AGL15 ----------->TGA1      <---------GATA12    --------->ICU4 <---------TOE2(3)<------
------------>AGL15 ----------->HVH21     --------->GATA12    <---------ATHB12----------->GT1--------
 
cttcaagaagaaccaagtcctcgtgacgatagagaaaactatgagatttccattaacaatccccatgatggaatcatatgaggtagaaatgatattgatg  11429800
                                                           <------ZmHOX2a(2)
                                                          --------->ARR11(2)
                                                          <---------ARR14(2)
                                                          <---------ARR11(2)
                                                          --------->ARR14(2)
                                                          --------->AGP1
                                                          <---------ARR11(3)
                                                      ------>ZmHOX2a(2)
                                                    <---------GATA12
                                                    <---------ARR11(3)
                                                    --------->ARR11(3)                        <-----
    --------->AHL20(2)                            <---------YAB1                       --------->DAG2
-------YAB1                                     --------->YAB5                         --------->DOF5.7(1)
---->YAB5            <----------DOF2            --------->YAB1                        --------->DOF5.7(1)
--->ICU4 <---------GLK1(2)             --------->CCA1(2)  --------->RVE1(2)          ---------->DOF2
--CBF   --------->AHL12(1)            <---------RVE1(2)   --------->GATA12       --------->HSFB2a(2)
----YAB1<---------AHL12(1)            --------->ARR11(1)  <---------GATA12       <---------HSFB2a(2)
---TOE2(3)   <---------YAB1 ---------->DOF2    --------->ICU4                    <---------------AGL15
->YAB1  --------->KAN1  --------->RVE1(2)      <---------KAN1 ---------->DOF2   ----------------->AGL1
 
atgaaaatgaaatattctcattttctttatctaaagagatagatatgagaatgatgatctagatccaaagacattacccgagtgccagaaaaggcgaaat  11429900
                                                                                                   <
                                                                                                   <
                                             ---------->DOF2                                     ---
                  --------->AtLEC2          <---------AHL20(2)                                 <----
                <---------ANAC46          --------->WOX13(2)                                   -----
                <---------ANAC58          <---------WOX13(2)                                   -----
                <---------ANAC58      --------->TOE2(3) *TSS<-----------GT1                    <----
           --------->KAN1             <---------DOF5.7(1) <-----------HVH21         <-----------RAV1(1)
      ----------->GT1       <------------CBF--------->AHL20(2)             <---------KAN1 <---------ZAT18
-------CBF--------->DOF5.7(1)    <---------GLK1(1)     <------------CBF    ----------->GT1--------->ZAT18
 
tgggagaaatagaaaaatgccttgcaagttgaattgaactcccttaataaaagaaacctattgtcacttcatttgagaatgtaaaacatgttgggcacaa  11430000
                                  <------ZmHOX2a(2)
                                 --------->GATA12
                                 <---------GATA12
------MYB46(1)             --------->ZAT2
------MYB83                <---------At4g35610
------>ALFIN1              --------->At4g35610
-----O2                    <---------ZAT2
---->O2               --------->DOF5.7(1)               <-----------RAV1(1)            --------->At4g35610
---->TGA1a        <---------WOX13(2)                <---------ALFIN1        ---------->DOF2
-----TGA1a        --------->WOX13(2)     <---------ARR11(3)            <-----------------AGL1
 
gtgggtatttgtgcgaaacaaaattaagagagctgagatcaaacgatattaagcccgacttgttgcccaaggtttctctcaaaggccatgagttgaatat  11430100
                                                                             <-----------GT1
                                                                  <---------AHL12(2)
                                                                  --------->WOX13(2)
                                                                 <--------ATHB1
                                                                 <---------AHL20(3)
                                                                 --------->AHL12(1)
                                                                 <---------ICU4
                                                                 --------->AHL20(2)
                                                                 <---------AHL20(2)
                                                                 <---------AHL25(1)
                                                                 --------->AHL25(1)
                                                                 --------->AHL25(2)
                                                                 <---------AHL25(2)
                                                                 --------->AHL20(3)
                                                     --------->RAP2.6(3) --------->CCA1(2)
                                                    --------->ARR11(2)  --------->ARR11(3)
                                                    <---------ARR11(2)  <---------RVE1(2)
                                                   <----------DOF2<---------WOX13(2)
               --------->WRKY18(1)                <---------DAG2 <---------AHL25(3)
              <-----------HVH21                   <---------DOF5.7(1)  <<<<<<<<<RAP2.2       <------
             --------->LBD16                      <----------DOF2--------->ATHB51            -------
           <---------LBD16                   <---------YAB5      <---------AHL12(1)        ---------
         <-----------GT1                    <---------WOX13(2)  <---------ATHB51        <---------REM1(1)
      <---------ARR14(2)                    --------->WOX13(2)  --------->ICU4         ------->TEIL
      --------->ARR14(2)                <---------ANAC55(2)     <---------ATHB12<---------DAG2
      <---------GLK1(2)                 --------->ANAC55(2)<---------At4g35610  <----------DOF2
     --------->KAN1         --------->AHL20(2)  ------->TEIL    --------->AHL25(3)  <---------TOE2(3)
 
gaagaaacatattctccggtcatggatgcaattacattcaagtacttaatgagcctttcggcatctaataatttagatatatactttatggatgtagtga  11430200
                                         --------->AHL12(3)
                                         <---------AHL12(3)
                                         <---------AHL20(2)
                                         --------->AHL20(2)
                                       <---------AHL12(3)
                                     <---------AHL12(3)
                                   --------->AHL12(3)
                                   <---------AHL20(2)
                      --------->YAB1 --------->AHL12(3)
                      <---------ICU4 <---------AHL20(2)
                    <---------RVE1(2)--------->AHL20(2)
              ------>ZmHOX2a(2)    <---------AHL12(3)
             <---------GLK1(1)     --------->AHL20(2)
             --------->GLK1(1)   --------->AHL12(3)
            <---------ARR11(3)   --------->AHL20(2)
            --------->ARR11(3)   <---------AHL12(3)                ---------->DOF2
            ------->TEIL         <---------AHL20(2)           --------->YAB5
            <---------ARR11(2) <---------AHL20(2)             ----------->GT1
            --------->ARR11(2) --------->AHL20(2)             <------ZmHOX2a(1)
     <---------AHL20(3)        <---------AHL12(3)       ------>ZmHOX2a(1)
     --------->AHL20(2)        --------->AHL12(3)   --------->ARR11(3)
     <---------AHL20(2)  --------->YAB1<---------AHL20(2)    --------->ICU4
     <---------AHL12(3) <---------YAB1 --------->AHL20(2)    ----------->GT1
     <---------AHL25(1) <---------YAB5 --------->AHL12(3) ---------->DOF2
---ZAT6     <---------AGP1   --------->AHL25(1)     <---------ARR14(2)
---->HVH21  --------->GATA12 <---------AHL12(3)     --------->ARR14(2)                          ----
-->GT1      <---------GATA12 --------->AHL12(3)     --------->GLK1(2)                        -------
 
caacttatttatatggatctcttgataatgatatatatatatatatatataagaaaatcctgaaaggattaaaagttatagaggcattaaacacatcaaa  11430300
<- Previous    Next ->

AGI:  At5g30942.1   
Description:  transposable element gene. gypsy-like retrotransposon family, has a 4.3e-162 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor)
Range:  from: 11424198    to: 11429766    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At5g31032.1   
Description:  transposable element gene. copia-like retrotransposon family, has a 1.4e-35 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)
Range:  from: 11429957    to: 11432905    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version