AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                            <---------AHL25(3)                                      --------->TOE2(3)
         ---------->DOF2    --------->AHL20(2)                ---------->DOF2 --------->ANAC58
    --------->RVE1(2)--------->YAB1  --------->TOE2(3)    --------->LBD16     --------->ANAC58
--------DOF2        <-------TEIL --------->DOF5.7(1)     --------->ANAC46 --------->YAB1
>RAV1(1) --------->KAN1    --------->AHL20(2)        <-----------GT1     <-------TEIL
ctttcaatacccaaatgctcaaattcataaataaaaaaaaccctaactttgcaatttcacccccaaaatgctcaaattcataagaaaccctagtttttca  9864600
              --------->ATHB12                --------->ARR14(2)
              <--------ATHB1            <---------ARR11(2)
              --------->KAN1            --------->ARR14(2)
             <---------YAB1             <---------GATA12                                           <
             <---------YAB5             <---------ARR14(2)                                 ---------
             --------->ICU4             --------->GATA12                                <---------GATA12
             <---------ATHB12           --------->ARR11(2)                              --------->GATA12
            <---------TOE2(3)          --------->KAN1                    <------MYB83   --------->ARR14(2)
          --------->AHL20(2)           --------->At4g35610               <------MYB46(1)<---------ARR14(2)
          --------->AHL25(1)         <-----------RAV1(2)     ==============================HOX2a_HOX2a
          <---------AHL20(2)        --------->LBD16          <------ZmHOX2a(2)          <---------ARR11(3)
          <---------AHL25(3)        <---------At4g35610     <---------GATA12            --------->ARR11(3)
          <---------AHL25(1)     <---------At5g28300        --------->GATA12          ----------->ARR10
        <---------WOX13(2)      <-----------GT1 --------->ALFIN1        --------->MYB59<---------HSFB2a(1)
        --------->WOX13(2)    <---------KAN1  <---------ARR14(2)        <---------TOE2(3)--------->CCA1(2)
 <-----------GT1     <------ZmHOX2a(2) <---------At4g35610  --------->ARR11(3)      <------ZmHOX2a(1)
aatttcaccctaattaatgattcgatcatgagaatttaccgcagatgcgaattggggcatggagatcaaggagattaggttgagagaggaagatttgacg  9864700
                  <---------ARR14(2)                                            <---------ARR11(3)
                  <---------GATA12                                              --------->ARR11(3)
                  ------->TEIL                                               --------->YAB1
  ---------->DOF2 --------->ARR14(2)   ------->TEIL  <---------DOF5.7(1)    <---------YAB1
  <---------DOF5.7(2)      <---------LBD16          <---------DOF5.7(1)    <---------AHL20(3)
--------->DOF5.7(2)<---------KAN1 --------->At4g35610<---------DAG2        --------->AHL20(3)  <----
-------GAMYB----------->HVH21     <---------At4g35610<----------DOF2      --------->YAB1      <-----
-->HVH21    --------->WRKY12   ---------->DOF2    ------>NtERF2          <---------YAB1  --------->KAN1
agcgttaaagcagagttgacgaatctcgctctcggaaagctgaacctgtttgcctcctttaccttctaacaatcttcttataatatcatccaatactcct  9864800
      ------>MYB46(1)    <---------ICU4       <---------ARR11(3)
      ------>MYB83      <---------YAB1        --------->ARR14(2)
    <---------ALFIN1    <---------YAB5        --------->ARR11(2)
    --------->AtMYB61   --------->ICU4        <---------ARR11(2)                                ----
   --------->MYB46(3)<---------YAB5           --------->ARR11(3)                                ====
 --------->ANAC46   <-----------TGA1         --------->At4g35610          <xxxxxxxxxxxxxxxxxxxsmallRNA(i2)
------DOF2         --------->ANAC46          <---------At4g35610       --------->RVE1(2)        ----
----DOF5.7(1)  --------->KAN1      <----------DOF2    --------->AHL12(2) --------->YAB1        -----
ttctccaccatcccttccatactcgtcatcatcgtgttctttctcttcagatccctaaaatattttctcaccaaaatcaaaacttgctacaagggtttgc  9864900
                                                       <------ZmHOX2a(2)        <---------HSFB2a(2)
                                                      <---------GATA12    <---------AHL12(1)
                                                      --------->GATA12    --------->AHL12(1)
                                        <---------ATHB12------>ZmHOX2a(2) --------->AHL20(3)
               --------->ICU4 <---------MYB46(3)      <---------ARR14(2)  <---------AHL25(1)
               <---------ATHB51 <<<<<<<<<MYB2         --------->ARR11(2)  <---------AHL25(2)
            ===================================HOX2a_HOX2a                --------->AHL25(1)
       <------ZmHOX2a(1)<-------GAMYB   <------ZmHOX2a(2)                 <---------AHL20(3)
    <-----------RAV1(2)<---------MYB46(3)             <---------ARR11(2)  --------->AHL25(2)   -----
------->RAV1(1)<---------KAN1 <------MYB46(1)         --------->ARR14(2) <---------KAN1       <-----
================RAV    --------->MYB52(2)         --------->CCA1(2)      <---------AHL12(1)---------
-->NtERF2   <------ZmHOX2a(1) <------MYB83--------->WOX13(1)            ------->TEIL     <----------
---->ANAC46----------->GT1<---------MYB46(3)<---------ATHB12 ---------->DOF2 <-----------GT1  <-----
gccagaaacaggagaggaataatgggtcgttgttggttttccgatcaatgaagagacgatcggagaaagtagacgaattttttccagagaaaatgtgggt  9865000
   --------->DOF5.7(1)                                                          --------->KAN1------
 ---------->DOF2                            <------ZmHOX2a(1)                 <---------KAN1<-------
---->WRKY18(1)                           <------ZmHOX2a(1)                 <----------ID1   --------
------HVH21                           <---------At4g35610                 --------->DOF5.7(1)-------
>ALFIN1                         --------->AHL12(1)   --------->YAB1     ---------->DOF2     --------
-RAV1(1)      --------->GLK1(1) <---------AHL12(1)  <---------YAB1 --------->CCA1(2)  ---------->DOF2
----PCF2  >>>>>>>>>TBF1  ---------->ID1  *TSS---------->DOF2     --------->CCA1(2)   --------->LBD16
caaacaaagagaagaagaaatctattttgtcttaaaaattcagaggaggaaagttatcaaaatggaagagataagaaaagaacaaatccgaaagaataaa  9865100
 <---------AHL20(2)                                                                           <-----
--------->AHL20(2)                                                                            <-----
-----AHL12(2)          <---------GATA12                                                       ------
----AHL12(2)          --------->GLK1(1)                                                       ------
-->AHL20(2)   --------->AHL20(2)                                                              <-----
---AHL12(1)   <---------AHL25(3)                                                             <------
---AHL20(1)   <---------AHL20(2)                                                             -------
-->AHL20(1)  --------->AHL20(3)                                                             --------
---AHL20(2)  <---------AHL12(3)                                                             <-------
-->AHL25(1)  <---------AHL20(2)                                                            <--------
-->AHL20(3)  --------->AHL20(1)                                                            <--------
-->AHL12(1)  --------->AHL20(2)                                 <---------AHL25(1)         ---------
---AHL25(3)  <---------AHL20(3)                                 <---------AHL20(3)      --------->YAB1
-->AHL25(3)  --------->AHL25(1)                                 --------->AHL20(3)     <---------ATHB12
---AHL25(1)  <---------AHL25(3)                                 --------->AHL25(1)     <---------YAB5
---AHL25(2)  --------->AHL25(3)                                 <---------AHL20(2)   --------->WOX13(1)
---AHL20(3)  <---------AHL25(2)                                 <---------AHL12(3) --------->MYB46(3)
------>YAB1  <---------AHL25(1)                                 --------->AHL20(2)--------->ANAC46
------>AHL20(2)   --------->YAB1                                --------->AHL12(3)--------->ANAC58
--->AHL12(2) --------->AHL25(2)                               <---------WOX13(1)  --------->ANAC58 -
--KAN1 ----------->GT1<---------GLK1(1)                     --------->ATHB12 <---------ARR14(2)   <-
->AHL25(3)  <---------AHL12(2)                     <---------GATA12          --------->ARR14(2)   <-
-->AHL25(2) --------->AHL12(2)                     --------->GATA12          <---------ARR11(2)  <--
->AHL20(2) <---------WOX13(2)                     --------->GLK1(1)          --------->ARR11(2)  ---
ttataaaatggggaaatttaataagaaatccaaaacttttgaaagtatttcagaaatctacattgatttatataagtgcaaatacacccaatcatatatt  9865200
       <---------ALFIN1               <---------AHL12(3)
      <---------ZAT18                 --------->AHL25(1)
      --------->ZAT18                 <---------AHL20(2)
----AHL12(3)                          --------->AHL25(3)
----AHL25(2)                          --------->AHL25(2)
--->AHL12(3)                          <---------AHL25(1)
--->AHL12(2)                          --------->AHL20(2)
----AHL20(2)                      <---------AHL12(2)
---AHL12(2)                       --------->AHL12(2)
-->AHL12(2)                      <---------AHL20(2)
->AHL12(3)                   ----------->GT1
--AHL20(2)             <---------AHL25(2)
-AHL20(1)              --------->AHL25(2)                                                       ----
-AHL25(2)<---------O2  <---------AHL25(1)                                      <---------ICU4 <-----
>AHL25(3)--------->O2  <---------AHL20(2)                                     --------->ICU4  <-----
-------->ATHB12        --------->AHL25(3)                                    --------->ANAC55(2)<---
--------YAB1           --------->AHL20(3)                                --------->YAB1   ----------
--------AHL20(2)       <---------AHL20(1)                      <---------ARR11(2) <-----------GT1
-------AHL12(2)        --------->AHL20(2)         <---------GATA12 --------->TOE2(3)      <---------ANAC46
------>AHL12(2)        --------->AHL25(1)  ----------->GT1     --------->ARR11(2)<---------YAB1-----
ttttattggtccacttggcatttcattttattttgttaaattttaatagtataaatctcatatatgtatacattaatcttacttattactgttttgtata  9865300
      <---------AHL12(2)                                              --------->AHL20(2)
     --------->AHL20(2)                                               <---------ATHB12
     --------->AHL12(1)                                              --------->AHL12(2)
     <---------AHL20(2)                                         <------MYB46(1)
     --------->AHL12(3)                                         <------MYB83
     <---------AHL25(1)                                    <---------AHL25(3)
     <---------AHL12(1)                                    <---------AHL20(2)
     <---------AHL25(3)                                   --------->AHL25(2)
     --------->AHL25(1)                                   <---------AHL25(3)
    --------->AHL20(1)                                    <---------AHL25(2)       <---------WOX13(2)
    <---------AHL20(1)                                    --------->AHL12(1)       --------->WOX13(2)
    <---------AHL12(1)                                    <---------AHL25(1)     <---------AHL20(2)
    --------->AHL20(2)                                    <---------AHL12(1)     <---------AHL25(3)
    --------->AHL12(1)                                    --------->AHL25(3)     --------->AHL25(1)
    --------->AHL12(3)                                    --------->AHL20(1)     --------->AHL12(1)
    <---------AHL20(2)                                    <---------AHL20(3)     <---------AHL12(1)
    --------->AHL25(2)                                    --------->AHL25(1)     --------->AHL20(2)
    <---------AHL25(2)                                    --------->AHL20(3)     <---------AHL20(1)
    --------->AHL25(3)                                    <---------AHL20(2)     <---------AHL25(1)
    <---------AHL25(3)                                    <---------AHL20(1)     <---------AHL25(2)
    <---------AHL25(1)                                    --------->AHL20(2)     --------->AHL20(1)
    --------->AHL25(1)                                   <---------AHL12(2)      --------->AHL25(2)-
    <---------AHL12(3)                                   --------->AHL12(2)     --------->AHL20(2) <
   <---------AHL12(3)                                   --------->WOX13(2)      <---------AHL12(3) -
   <---------AHL12(2)                                   --------->AHL12(2)      --------->AHL25(1) -
   --------->AHL12(2)  <---------ARR14(2)               <---------WOX13(2)      --------->AHL12(3) <
   --------->AHL12(3)  --------->ARR11(2)           --------->ANAC55(1)         <---------AHL25(1)--
----->WOX13(2)--------------->AGL15                 --------->ANAC55(2)--------->AHL20(2)         --
----YAB1     ----------------->AG<---------ZAT6     --------->ANAC46 --------->WOX13(2)          <--
----AHL20(2) <-----------------AGL1                 <---------ANAC55(2)<---------AHL20(2)    <------
------WOX13(2)<---------------AGL15            <---------WRKY12--------->MYB59  --------->AHL25(3)--
->GT1<---------AHL12(3)<---------ARR11(2)      <---------WRKY38(1)   <---------WOX13(2)    ---------
---->ATHB51<-----------GT1 --------->YAB5     --------->WRKY18(1)   --------->WOX13(1)    --------->ALFIN1
attgaaatttattttttccaagtggggaaacgtttagtattagaagaaggtcaacacataatttattaggtcaattaatagaaataaattgaagtgggcc  9865400
       <---------ICU4                                                                              <
       --------->YAB1                                                                              <
      <---------AHL20(2)                                                                           <
   <---------AHL20(2)                                                                              -
  <---------AHL20(2)                                                                              <-
  <---------AHL20(3)                                                                              --
  --------->AHL20(3)                                                                              --
  --------->AHL20(2)                                                                              --
<---------AHL12(2)                                                                                --
-------->AHL12(3)                  --------->AHL12(2)                                             --
---------AHL20(2)            <---------TOE1(3)                                     --------->HSFC1(1)
-------->AHL25(2)            <---------TOE2(3)                           --------->YAB1           <-
-------->AHL25(1)       --------->YAB5                                  <---------ATHB12          --
---------AHL25(2)      <---------YAB1                       --------->TOE1(3)      <---------HSFC1(1)
------->AHL25(1)    <---------AHL20(2)              <-------TEIL       ------>MYB46(1)           <--
------->AHL25(3)  <---------WOX13(2)              --------->GATA12     ------>MYB83<---------HSFB2a(2)
-------MYB52(1)   --------->WOX13(2)             --------->At4g35610 --------->AtMYB61           ---
---PCF2--------->YAB5 <---------TOE2(3)          <---------At4g35610 <---------MYB59             ---
------->AHL20(2)------>ZmHOX2a(1)<XXXXXXXXXXXXXXXXXXXXXMIR173  --------->REM1(2)   --------->HSFB2a(2)
>ZAT18<---------YAB1--------->AHL25(3)  <-----------GT1     --------->TOE2(3) ------->TEIL<---------
attaattttataattactcctaatttatgtttatggtttttttttacaagtgagatgcacaaaccttgaagaccaaacatgaacttctagaaaactacaa  9865500
<- Previous    Next ->

AGI:  At5g27840.1   
Description:  TOPP8 (Type one serine/threonine protein phosphatase 8); protein serine/threonine phosphatase. Identical to Serine/threonine-protein phosphatase PP1 isozyme 8 (TOPP8) [Arabidopsis Thaliana] (GB:O82734;GB:Q8LAG7;GB:Q94B49); similar to serine/threonine protein phosphatase, putative [Arabidopsis thaliana] (TAIR:AT3G05580.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN74238.1); contains InterPro domain Metallophosphoesterase; (InterPro:IPR004843); contains InterPro domain Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase; (InterPro:IPR006186)
Range:  from: 9862927    to: 9865042    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version