AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                   <-------TEIL
                                                                 --------->GATA12
                                                                 <---------GATA12
                                                                 --------->ARR11(2)
                                                                 --------->ARR14(2)
                                                                 --------->ARR11(3)
                                                                 --------->AGP1
                                                            =============HOX2a_HOX2a
                                                       --------->SPL7(1)
                                                      ------>MYB46(1)
                                                      ------>MYB83<------ZmHOX2a(2)
                                                      --------->MYB52(1)                        ----
                                               <------NtERF2<------ZmHOX2a(1)     --------->ANAC58
                                  <---------TOE2(2) ------->GAMYB--------->RVE1(2)--------->ANAC58
                            --------->ANAC46 <---------DEAR3(1)  <---------ARR14(2)           <-----
                            --------->ANAC58 --------->ANAC58    <---------ARR11(3)     --------->AHL12(1)
                         --------->ZAT14     --------->ANAC58    <---------ARR11(2)--------->LBD16--
                         <---------ZAT14    --------->SPL7(1)---------->DOF2     <---------LBD16<---
                         <---------ZAT18    --------->RAP2.6(3)--------->DOF5.7(1)--------->LBD16---
   <---------At4g35610   --------->ZAT18<---------------AtSPL3 --------->HSFB2a(1)<---------HSFB2a(2)
----------CDC5 --------->At4g35610<---------TOE1(2)--------->MYB46(3)     <----------DOF2   <-------
-MYB46(3)   ---------->DOF2 --------->ANAC58--------->ATERF1(1)<---------HSFB2a(1)--------->HSFB2a(2)
 
gggctgagcttatacaaaagctgagaagtgcacggcctaggtatggggacggcaaccgaacgaggaaagatccatttcttttcgcccggaaattttctcc  8792600
                                               --------->ARR11(2)
      --------->WOX13(1)                      <---------ARR14(2)
    <------ZmHOX2a(2)                         --------->ARR11(1)
 <------NtERF2                               --------->YAB5
<------NtERF2                              <---------TOE2(3)               <------MYB83
--------->LBD16                            <---------TOE1(3)     --------->YAB1
-->NtERF2                                 <---------DOF5.7(2)  <---------WOX13(2)   --------->At4g35610
----LBD16  --------->At4g35610            <-----------GT1      <---------AHL12(2)   <---------At4g35610
------->SPL7(1)                         --------->DOF5.7(2)    --------->WOX13(2)   --------->WOX13(2)
------SPL7(1)      ------->TEIL        --------->TOE2(3)       --------->AHL12(2)   <-------GAMYB
--->NtERF2 <---------At4g35610         <----------DOF2    ----------->GT1  <------MYB46(1)        <-
----GT1 <---------ATHB12             --------->ICU4       <---------ANAC46--------->MYB59   <-------
 
ggccgggatcaatcagttgatgaacataactcgaagtgtcatctttaacgattcggctcttgtgtaaattatagtatttggtatttcagttgagacttta  8792700
                                                               <---------TOE2(3)
                                 --------->YAB5             --------->AHL20(3)
                               <---------TOE2(2)            <---------AHL20(2)
                               <---------TOE1(2)            <---------AHL20(3)        <---------TOE2(3)
                            <---------ANAC58     --------->LBD16                     --------->YAB1-
                            <---------ANAC46    <---------ANAC58                     <---------ICU4<
         <------MYB83 <---------ARR11(3)        <---------ANAC46                    <---------ATHB51
     <---------RVE1(2)--------->ARR11(3)        <---------ANAC58                    <---------ATHB12
    --------->ATHB12  <---------RVE1(2)         <---------AtLEC2                 --------------->AGL15
--------ZAT18       <---------TOE2(3)        ------->TEIL------->TEIL           ----------------->AGL3
---DOF2  <------MYB46(1)    <---------ANAC58--------->KAN1 --------->AHL12(2)   ----------------->AGL1
 
ggggacttgatttggtttcatttgagatttttcgtatgtttaaacatgtatgcgtggatgtatattaatgttatatgaaagtttccaataatgttatagc  8792800
                                                                                           ---------
                                                                                           <--------
                                             ---------->DOF2                              --------->YAB5
                                   <---------WOX13(2)                                    --------->AHL20(2)
                                 <---------AHL25(1)                                      <---------YAB1
                                 --------->AHL25(1)                                      <---------AHL25(1)
                                 --------->AHL25(2)                                      --------->AHL25(1)
                                 <---------AHL20(3)                                      <---------AHL12(3)
                                 --------->AHL25(3)                             --------->KAN4(2)
                                 <---------AHL25(2)                            --------->KAN1
                                 <---------AHL25(3)                            <---------KAN4(1)
                                 --------->AHL20(1)                            --------->KAN4(1)
                                 --------->AHL20(3)                            <---------KAN1
                                 <---------AHL20(1)                           <---------YAB1--------
                                 --------->AHL20(2)                          <---------GLK1(2)
     <---------TOE1(3)           <---------AHL20(2) <---------------AtSPL8   <---------ARR11(3)
     <---------TOE2(3)  ---------->DOF2  <------ZmHOX2a(1)             <-----------GT1   <---------AHL20(2)
-------->ARR11(3)  --------->RVE1(2)   <---------TOE2(3)            <---------ICU4      --------->AHL25(3)
---------ARR11(3)  <---------GATA12--------->WOX13(2)              --------->ICU4       --------->AHL20(2)
 
aagattttagggttttgctataaatctaaaagctattttattaaggagaaaagtttttgtacgaagactaaatattacaagattattccgatataattag  8792900
                                                                  ------>NtERF2
                                                                  <---------ATERF1(1)
                                                                 --------->RAP2.6(2)
                                                                 --------->DEAR3(1)
                                                                 ----------->HVH21
                                                                --------->ATERF1(1)
                                                               <---------ATERF1(1)
                                                               ------>NtERF2
                                                               <------NtERF2
                                                              --------->DEAR3(1)
                                                             <---------RAP2.6(2)
                                                          --------->DOF5.7(1)
                                                         --------->CCA1(2)
                                                         ---------->DOF2
                                  --------->DOF5.7(1)   --------->ARR11(2)                <---------KAN1
                                ---------->DOF2         <---------ARR14(2)               --------->GLK1(2)
                             <---------WOX13(1)       --------->ANAC58               --------->ANAC46
                            <------------CBF          --------->ANAC58         <---------------AGL15
                           --------->YAB5             <--------------OsCBT     ------>ZmHOX2a(1)
                           --------->ATHB12           --------->ANAC46        --------------->AGL15
>WOX13(2)                  -------->HAHB4         --------->YAB1--------->DEAR3(2)   --------->ANAC58
-WOX13(2)                 <---------YAB1       <---------GLK1(1)--------->SPL7(1)    --------->ANAC58
->ICU4 ----------->GT1    --------->ICU4   >>>>>>>>>TBF1--------->ARR14(2)    --------->TOE2(3)
 
taaatggaaatggtaaaattagtaagaaaatgattgaaagagagaagaagaaatcacaagaaacgcggccgaccctaacttcctcaacaaggaatctagg  8793000
                                                       --------->KAN1
                                                 <---------MYB52(1)
                                               <---------ANAC46
                                               <---------ANAC58
                    *TSS    --------->TOE2(3)  <---------ANAC58
                   ----------->GT1          <---------ARR14(2)                    --------->ANAC58
                   <---------ANAC46         --------->ARR14(2)             <---------KAN1  ------>ZmHOX2a(1)
                  <-----------------------TaNAC69(2)<---------At4g35610--------->ANAC46  <---------DOF5.7(1)
               <------ZmHOX2a(1)            --------->ARR11(2) --------->MYB46(3) --------->ANAC46
             <---------TOE2(3)              <---------ARR11(2)--------->SPL7(1)   --------->ANAC58
            --------->MYB52(1)    --------->YAB1<-----------HVH21  <---------ALFIN1  --------->KAN1<
 
catttacaacaaaactaaggaagcgtaaaaacctctatcatcaccaagttccgtcgtctgattcgaacccccatacgaatcagacaagacactccttcca  8793100
                                           --------->TOE2(3)
                                           --------->TOE1(3)
                                        <-----------GT1
                                      <---------AHL20(2)
                                      <---------AHL25(1)
                                    <---------AHL12(2)
                                   <---------AHL12(2)
                                  <---------AHL12(3)
                                  <---------AHL25(3)
                                  --------->AHL12(1)
                                  <---------AHL12(1)
                                  --------->AHL25(2)
                                  --------->AHL12(3)
                                 --------->AHL12(1)
                                 --------->AHL20(2)
                                 <---------AHL25(1)
                                 --------->AHL25(1)
                                 --------->AHL12(3)
                                 <---------AHL20(2)
                                 <---------AHL12(3)
                                 <---------AHL25(3)
                                 --------->AHL25(2)
                                 <---------AHL12(1)
                                 <---------AHL25(2)
                                 --------->AHL25(3)
                                --------->AHL25(1)
                                <---------AHL25(2)
                                --------->AHL12(3)                          --------->WOX13(1)
                                --------->AHL25(3)                        <---------YAB5
              <----------DOF2   --------->AHL25(2)  --------->ATHB12   <---------YAB5
-----------GT1------>ZmHOX2a(1) --------->AHL20(2) <-------TEIL     ------>ZmHOX2a(1)       --------
 
atataccatacttcatcctttgattcaaataccaaaaaaatttaaaccctaaaattcatttgagtctcttcctagtcatcaatctcttgaaaccctgatt  8793200
                      ------>ZmHOX2a(2)
                    <---------ARR11(3)                     <---------DAG2
                    --------->ARR11(3)       <----------DOF2<---------DOF5.7(1)
                    <---------RVE1(2)      <---------HSFB2a(1)
            <-----------GT1                --------->HSFB2a(1)
         <---------ARR11(3)                <---------HSFC1(2)                              <--------
         --------->ARR11(3)                --------->HSFC1(2)        --------->YAB5   ------->TEIL
         <---------RVE1(2)        <---------ATHB51         <----------DOF2         --------->ANAC58
         <---------GATA12         <---------AHL20(2)       <---------DOF5.7(1)     <---------MYB52(2)
         --------->GATA12       --------->WOX13(2)     --------->LBD16             <---------KAN1<--
         <---------GLK1(2)      --------->AHL12(2)    --------->DEAR3(1)           --------->MYB46(3)
      --------->HSFB2a(2)     --------->AHL20(2)     <---------LBD16<---------YAB1--------->SPL7(1)
->KAN1<---------HSFB2a(2)     <---------AHL20(2)   --------->DEAR3(1)--------->YAB1--------->ANAC58
 
ccatggtttctagattttccattgatcttgtttttaaataatgggaagctttcatcgccggactttttcttatgataaacttccgaacgaacccattagg  8793300
                                                                                          <---------DOF5.7(1)
                                                                                          ------>ZmHOX2a(1)
                                                                                          <---------
                                                                                         <---------DOF5.7(1)
                                                                                     --------->YAB1
                                                    <----------DOF2                  <---------ICU4
                                                   <---------DOF5.7(1)              <---------YAB5
                                                 --------->ARR11(3)                 <---------ATHB12
                                           --------->YAB1                         --------->WOX13(1)
                                          <---------YAB1     ---------->ID1       <-----------GT1
   <---------MYB52(1)            --------->KAN1  <---------ARR11(3)             <---------YAB1
-MYB52(1)                 <----------DOF2 <---------YAB5    <-----------------AGL1--------->YAB1 <--
-------GLK1(1)       <---------DOF5.7(1)--------->REM1(1)   <-----------GT1  --------->ICU4<--------
 
ctctccgttctcaaactagatggctcttcctttggtaaatgcttcatcatagtatcttttttttttcgttttggtcactacttattaatcatcctttttt  8793400
              <---------AHL25(3)
              <---------AHL20(2)
             <---------AHL12(2)
             --------->AHL25(2)
             --------->AHL20(2)
             --------->AHL12(3)
             <---------AHL25(1)
            --------->AHL12(2)
           --------->AHL25(2)
           <---------AHL20(3)                                    --------->GLK1(1)
           <---------AHL25(2)                                    <------ZmHOX2a(2)
           --------->AHL20(3)                                   --------->ARR11(2)
           <---------AHL12(1)                                   --------->ARR11(3)
       <---------AHL20(2)                                       <---------ARR11(3)
      --------->AHL20(2)                                        --------->ARR14(2)
    --------->WOX13(2)                <---------ANAC58          --------->GATA12
    <---------WOX13(2)                <---------ANAC55(2)       <---------ARR14(2)
  --------->AHL20(2)                  --------->ANAC55(2)       <---------GATA12
  <---------AHL20(2)                  <---------ANAC46    <---------MYB52(1)
  --------->AHL25(3)                  <---------ANAC58 <------NtERF2
<----------DOF2                       <---------ANAC55(1)<-------GAMYB
--------->TOE2(3)                    <---------TOE2(3)------>NtERF2
--------->TOE1(3)                    <-----------------------TaNAC69(2)  <--------P
-DOF2 <---------AHL20(2)         --------->YAB5      <---------ALFIN1 <---------TOE2(3)
---------GT1<---------AHL12(2) <---------ARR11(3)  ------>NtERF2<---------ARR11(2)
-DOF5.7(1) --------->AHL12(1)  --------->ARR11(3)--------->TOE1(1)------>ZmHOX2a(2)               --
 
taactttaatttaaaattttatctactatgtgaagatgtttacgtattgacctcggccaccgttggggatctcaaggttgctatagaaactgccttcagc  8793500
<- Previous    Next ->

AGI:  At5g25330.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G32290.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO44242.1); contains InterPro domain Protein of unknown function DUF266, plant (InterPro:IPR004949)
Range:  from: 8791516    to: 8792816    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At5g25340.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G32270.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO44248.1); contains domain G3DSA:3.10.20.90 (G3DSA:3.10.20.90); contains domain SSF54236 (SSF54236)
Range:  from: 8793021    to: 8794787    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version