AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                              <--------P         <---------AGP1
                xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)          <------MYB83
               xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)          <------MYB46(1)
               xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)      <---------ARR14(2)
              xxxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)      --------->ARR14(2)
         <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)   <---------GATA12
     xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)        <---------RVE1(2)
     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3) <---------YAB1xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
  --------->ARR11(3)    <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)--------->MYB59             <----------
  <---------ARR11(3)   xxxxxxxxxxxxxxxx>smallRNA(i)  <xxxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)       <-
------ANAC58  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(s2) ------>ZmHOX2a(2)                  <---------RVE1(2)
------ANAC58 xxxxxxxxxxxxxxxxxxxx>smallRNA(le3)  --------->ARR11(3)         ---------->DOF2---------
----->ANAC46 <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)<------ZmHOX2a(2)      <----------DOF2 --------->KAN1
->KAN1   <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)   <---------ARR11(3) <---------At4g35610<---------WOX13(1)
cgtaagttcttatcaacttgtaatggtcttctggttgcaccatatgctcatagatctagtgtatttggtacaactgcttaaaagtttttgatttactcta  8052100
           --------->GATA12               <---------TOE2(3)
           --------->ARR14(2)     --------->ALFIN1
           <---------ARR14(2) --------->DOF5.7(1)                                                  <
           <---------GATA12------>ZmHOX2a(1)                                        <---------AHL20(2)
         ----------->ARR10--------->TOE2(3)                               <---------ANAC46         <
-GT1--------->MYB52(1)    --------->TOE1(3)                              <-------TEIL              -
--------AHL20(1)       xxxxxxxxxxxxxxxxxxxxxx>smallRNA(s2)    <---------ATHB12      --------->AHL20(2)
>ZAT6  ------->GAMYB   <-----------GT1  <---------AHL20(2)    <---------YAB1--------->ANAC55(2)  ---
gtatatttaacggagatttgcctatttttccttaagggtgtgtttaatgttttcatgttgaaacaatgaatgaagtttcatgtaattttaaatgaatgag  8052200
--------->YAB1<------ZmHOX2a(2)                                                                   <-
---------YAB5--------->ARR11(2)                                                                   --
---------ATHB12                                                 <---------ZAT18                -----
-------->ICU4<---------ARR11(2)                             <---------YAB1                    ------
------>WOX13(1)    <----------DOF2                  --------->KAN1                          --------
caatcataatgaaaccgatctactttgaagtttgaacatacaatagaattgactcatatgcttataatggactcaccatctatgtttcactgctaccaca  8052300
                                           <---------AHL12(1)   <---------AHL12(1)
                                         --------->AHL12(2)     --------->AHL12(2)
                                     <-------GAMYB              <---------AHL12(3)
                                    <---------MYB46(3)          --------->AHL25(3)
                                    ----------->GT1             <---------AHL25(2)
                                    <------MYB83                --------->AHL25(2)
                            <----------DOF2--------->AHL12(1)   <---------AHL25(1)
--------------AGL15       <---------DOF5.7(1)              ----------->GT1              ------>MYB46(1)
------------->AGL15 --------->KAN1  <------MYB46(1)      ----------->GT1        --------------->AtSPL8
------>RAV1(1)  <-----------GT1    <---------AtMYB61   --------->DOF5.7(1)   --------->AHL20(2)
--->ANAC46     <-------TEIL<---------DOF5.7(1)   <---------TOE2(3)<---------AHL12(1)------->TEIL
->AtMYB61    <---------GLK1(2)  <-----------RAV1(1)  ---------->DOF2      --------->YAB5------>MYB83
acattttttggtaaaagattcactaatccctctttgtgttggttaaaaaatcaaggtaaagagagaaaaaatttcaaagattatatgtaccaaatgaaca  8052400
                                            <---------LBD16                               <---------ANAC58
                                     --------->CCA1(2)                                    <---------ANAC46
                                    --------->ARR11(3)  --------->YAB1                    <---------ANAC58
                <---------WOX13(2)  --------->AHL20(1)  <---------ICU4             <---------At5g28300
                <---------YAB1      <---------AHL25(3) <---------YAB5              <---------LBD16
           ----------->GT1         <---------AHL12(3)  <---------YAB1          <----------DOF2 <<<<<
         --------->DOF5.7(1)  ----------->GT1<---------LBD16       --------->AHL20(2)    <------NtERF2
        --------->DOF5.7(1) --------->DOF5.7(1)  <---------AtMYB61 --------->AHL25(1)   <---------MYB46(3)
       --------->DOF5.7(1) --------->DOF5.7(1)  <--------P <-----------GT1    <---------DOF5.7(1)
       ---------->DOF2     ---------->DOF2 <---------LBD16<---------YAB1<-----------GT1 ------>NtERF2
  ---------->DOF2  <---------HSFB2a(2)    ------->TEIL --------->ICU4<---------AHL12(2) --------->ABI4(2)
atttgaaaagaaaagggttattttagaagtaaaaggaaatatatggaccggggaggttattattacagaattaaaaaaccctctttcacggtggcttctt  8052500
                                              --------->DOF5.7(1)                                ---
                                            ---------->DOF2                      --------->LBD16 <--
                                       --------->SPL7(1)                       --------->At4g35610
                                      --------->MYB52(1)                  ------>ZmHOX2a(1)      <--
                       <---------TOE2(3)--------->ANAC58           ----------->HVH21             ---
      *TSS             <---------TOE1(3)--------->ANAC58   <---------ANAC58    <---------At4g35610
<----------DOF2  <---------AHL12(1)  <---------SPL7(1)     <---------ANAC58    <--------------------
<<<<TBF1 <---------At4g35610   --------->ARR11(2)         <---------DEAR3(1)   <---------LBD16   <--
cttctttagttcatcggagaaattttagggtttatatcggcgaacggaaaagatgggtacttcggtgcaagtgactcctctctgcggagtttacaacgag  8052600
 ------>ZmHOX2a(1)                                 <-------GAMYB                               -----
------>ARR11(2)                                   --------->MYB55(2)              --------->TOE1(1)
------>GLK1(2)                                    <---------MYB46(3)    --------->O2          <-----
-------ARR11(2)                        ------>ZmHOX2a(1)  <---------HSFB2a(1)    <---------HSFB2a(2)
---------ARR10                         ==============================HOX2a_HOX2a --------->HSFB2a(2)
------>ARR14(2)        --------->YAB1  =============================HOX2a_HOX2a  ------>ZmHOX2a(1)
-WRI1   ------>ZmHOX2a(1) <---------MYB46(3)     <---------AtMYB61    <---------ALFIN1<---------KAN1
-------ARR14(2)     --------------------->WRI1 <-----------RAV1(1) --------->ANAC46  ------->TEIL
aatcctctctcctacttagtctccattgatggtttcaacttcctcatcgactgtggttggaacgatctcttcgacacatcgctcctcgaacctctctcca  8052700
         --------->ICU4  --------->HSFB2a(2)
         <---------YAB1  --------->HSFC1(1)                                     <---------ANAC46
        --------->TOE2(3)<---------HSFB2a(2)                                    <---------ANAC58  --
---->LBD16    <-----------GT1       --------->WOX13(1)                          <---------ANAC58  <-
------RAV1(2) --------->RVE1(2) <-----------GT1           <---------GLK1(2)  <--------P       <-----
ggtttctctatccttattatctacatttccagaattcaccaatctaatttgttttgaattcgattcttctggtttacagggttgcttctactatagatgc  8052800
                <---------ARR14(2)                       <---------ANAC46
    <----------DOF2                                     --------->ZAT2
   <---------ANAC58              <---------ZAT18        --------->At4g35610     <---------YAB1
   <---------ANAC58  --------->ANAC46                <---------At4g35610      --------->KAN1
------->ARR14(2)--------->ARR14(2)                ---------->DOF2    --------->At4g35610
--------ARR14(2)<---------ARR11(2)        --------->KAN1<---------ZAT2    ------>ZmHOX2a(1)
--TEIL          --------->ARR11(2)       ------>ZmHOX2a(1)           <---------At4g35610
agttttgctttctcatccagatacacttcacattggtgctcttccttatgctatgaagcagcttggactctccgctcctgtttatgctactgagcctgtt  8052900
                                                  --------->GLK1(2)       <---------YAB1
                                                 --------->GATA12    <---------MYB46(3)
                                                 --------->ARR11(3)  ----------->GT1
                                                 <---------ARR11(3) --------->ALFIN1
                                               ----------->ARR10  <---------ANAC58
            ------>ZmHOX2a(1)              <------MYB83           <---------ANAC46
     <------MYB46(1)                       ----------->GT1      --------->ZAT14
     <------MYB83                          <------MYB46(1)      <---------ZAT14  --------->LBD16
    --------->MYB59                     <------ZmHOX2a(1)    --------->MYB52(1) --------->ANAC46  <-
 <---------RVE1(2)     --------->YAB1<---------LBD16      <---------WOX13(2)   <---------LBD16 -----
catagattaggtctccttacaatgtatgatcagtttttgtccaggaaggtgagattttgttaactactggagtggttatttttgcgcaattgtctgcatt  8053000
<- Previous    Next ->

AGI:  At5g23880.1   
Description:  ATCPSF100/CPSF100/EMB1265/ESP5 (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR); DNA binding / protein binding. Identical to Cleavage and polyadenylation specificity factor subunit 2 [Arabidopsis Thaliana] (GB:Q9LKF9;GB:Q9FF92); similar to CPSF73-I [Arabidopsis thaliana] (TAIR:AT1G61010.2); similar to CPSF73-I, protein binding [Arabidopsis thaliana] (TAIR:AT1G61010.1); similar to CPSF73-I [Arabidopsis thaliana] (TAIR:AT1G61010.3); similar to unnamed protein product [Vitis vinifera] (GB:CAO49431.1); similar to hypothetical protein OsJ_029214 [Oryza sativa (japonica cultivar-group)] (GB:EAZ45731.1); similar to hypothetical protein OsI_031377
Range:  from: 8052507    to: 8058357    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version