AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                      --------->DAG2
                                                                     ---------->DOF2
                                                             <---------REM1(1)
                                                             <---------ANAC46
                                                          <---------AtMYB61
                                               <----------DOF2    <------ZmHOX2a(1)
             ----------->GT1                   --------------------->WRI1
             <---------WOX13(2)             <-----------GT1<---------ANAC46   ----------->GT1
            ----------->GT1       --------->ANAC58   --------->MYB52(2)      <---------------AtSPL8
      ---------->DOF2             --------->ANAC58 <---------MYB52(1)--------->DOF5.7(1)
   ----------->RAV1(1)     --------->TOE2(3)<---------AHL20(2)  ----------->GT1
 
aaacaacaacaaagtaagttaaaattcaaacgttgataagaaactatttactttgttagttttggtgtaggaaaaagtaagtggtacaaatagacgtttt  8004800
                                           --------------------->WRI1
                                          --------->ATHB12    --------->TOE2(3)
                                          <---------ICU4      --------->TOE1(3)               <-----
                        <---------YAB1   --------->ICU4     -------->P                --------->AHL25(3)
                      <-----------GT1    <---------YAB5   --------->MYB46(3)        --------->GATA12
            --------->YAB5        --------->YAB1 --------->WOX13(2)                 <---------ARR11(3)
           <---------YAB5--------->YAB5  <---------YAB1   <---------KAN1            --------->ARR11(3)
          <---------TOE2(3)      <------ZmHOX2a(2)  <-----------GT1       <-----------HVH21 <-------
        <---------AHL20(2)    <---------YAB1     <---------WOX13(2)     <---------YAB5--------->AHL12(1)
 
gtttttggtttttaatgtttcggtgttaccattacgatcatctcatcattgtaatttacgaacaacctcaatctaatggtcagtgaagatttattgtgat  8004900
                                                                       <---------AHL25(1)
                                                                       <---------AHL20(2)
                                                                       <---------AHL25(3)
                                                                      --------->AHL20(2)
                                                                      <---------AHL25(1)
                                                                      --------->AHL25(1)
                                                                      <---------AHL20(3)
                                                                      --------->AHL20(3)
                                                                      <---------AHL20(1)
                                                                      <---------AHL20(2)
                                                                      --------->AHL20(1)
                                                                      --------->AHL25(2)
                                             ------>ZmHOX2a(1)        --------->AHL25(3)  --------->ATHB12
                                             <----------DOF2        <---------WOX13(2)   --------->ICU4
                     <---------AHL20(2)     <---------DOF5.7(1)     --------->WOX13(2) -------------
                 <----------DOF2      --------->MYB52(1)         <---------ATHB12     --------------
                <---------DOF5.7(1)   <---------DOF5.7(2)      --------->WOX13(1)     ==============
          <-----------GT1           --------->DOF5.7(2)    --------->ANAC58           <-------------
----RVE1(2)   --------->ARR11(3)   <---------WOX13(2)      --------->ANAC46       <---------KAN1
--YAB1 ----------->GT1             --------->WOX13(2)      --------->ANAC58      --------->GLK1(2)
 
agtagtcgaaatgttactatcttttttattcaacatttagttaacgtcctttcgcctactacaagtcaatcaatttaatacaagaatttgccatgtttgg  8005000
                                     --------------->AGL15
                                     <---------------AGL15
                                    <---------ANAC58
                  ------->GAMYB     ----------------->AGL3
                 <---------MYB52(2) ----------------->AGL1
                 --------->MYB46(3) ----------------->AGL2
           --------->bZIP60(2)      <---------ANAC46
           --------->ANAC58         <---------ANAC58         <----------DOF2
-->AGL15   --------->O2         <---------ANAC58            <---------DOF5.7(1)
--->AG     --------->ANAC46     <---------ANAC58         <---------PCF2                >>>>>>>>>GATA-1
======================================================MADS_MADS    ----------->HVH21 ----------->GT1
----AGL1   --------->ANAC58  <----------DOF2            ----------->HVH21        <------ZmHOX2a(1)
 
ctatataagtagccacgacaacaaacttcacactttcttgcctgaaatagaattcacatgggacctttctctgacatttgcataggaatagataaactca  8005100
                                                                                 --------->KAN1
                                                                                <---------AHL25(3)
                                                                                <---------AHL20(1)
                                                                                <---------AHL20(2)
                                                                                --------->AHL20(1)
                                                                                <---------AHL25(2)
                                     <---------AHL12(2)                         --------->AHL20(3)
                                    <---------AHL25(1)                          <---------AHL20(3)
                                    <--------HAHB4                              --------->AHL25(2)
                                    <---------AHL12(1)                          <---------AHL25(1)
             <---------ANAC46       --------->AHL12(1)                        <---------YAB1
             <---------ANAC58       -------->ATHB1                           <---------AHL20(3)
             <---------ANAC58       --------->ATHB51                <---------AHL25(3)
        <-------TEIL                <---------AHL25(3)              <---------AHL20(3)
     --------->AHL12(1)             --------->AHL25(1)              <---------AHL20(2)
     <---------AHL12(1)             <---------AHL20(2)              <---------AHL25(1)
   --------->AHL25(2)              <---------ATHB12                 --------->AHL20(3)
   <---------AHL25(2)              --------->ICU4          --------->ANAC58  <---------AHL25(2)
   <---------AHL12(3)              --------->AHL25(3)      --------->ANAC58  --------->AHL20(3)
   --------->AHL12(3)              <---------ATHB51       --------->DOF5.7(1)--------->AHL25(2)
   <---------AHL12(2)         --------->ANAC46            --------->DAG2   ------->TEIL
   --------->AHL12(2)       <-----------GT1              ---------->DOF2 --------->YAB5
  --------->YAB1        --------->YAB1         ----------->GT1      --------->AHL20(2)  <---------TOE2(3)
 <---------KAN1      ----------->GT1--------->AHL20(2)   --------->DOF5.7(1) --------->AHL20(2)
 
tagaataaaaattcatacgtggattagtaataaacccaattatttactgagggaaaaacaaaaagccatattaaaatgaatattatattctaatgtatta  8005200
            <---------AHL12(1)
            --------->AHL12(1)
           <---------AHL25(2)
           --------->AHL12(3)
           <---------AHL12(1)
           <---------AHL12(2)
           <---------AHL25(3)
           --------->AHL12(1)
           --------->AHL25(1)
           <---------AHL25(1)
           --------->AHL25(2)                                     <---------YAB5
          <---------AHL25(2)                                    ------->GAMYB
          --------->AHL25(3)                                   --------->MYB46(3)
          --------->AHL12(3)                                 ----------->RAV1(1)
          <---------AHL12(3)                                 --------->MYB52(1)
          <---------AHL25(1)                              --------->ANAC58
          --------->AHL20(2)                              --------->ANAC58
          --------->AHL25(1)              <------MYB83  ---------->DOF2
          --------->AHL25(2)          --------->ATHB12===================RAV
      --------->AHL20(2)         <<<<<<<<<MYB2        <-----------RAV1(2)
      --------->YAB1           <------MYB83          <---------LBD16
    --------->WOX13(2)         <------MYB46(1)   --------->ARR11(2)--------->YAB1
    <---------WOX13(2)        <---------AtMYB61  --------->ARR14(2)--------->YAB5
   --------->YAB1           <------------CBF     <---------ARR14(2)<---------ICU4
 <---------YAB1     <---------YAB1  *TSS  <------MYB46(1) --------->ANAC46               --------->ZAT6
 
aactattaataaaaaaaattcttttgaatgggattggttttcgattggtccgaaaccccagaagcaacagtcattactctgttttcatatgaacactctt  8005300
                                                           <---------DOF5.7(1)
                                                           =====================================HOX2a_HOX2a
                                                           ------>ZmHOX2a(2)
                                                           ==================================HOX2a_HOX2a
                                                          <------ZmHOX2a(2)
                                                          <---------KAN1
                                                          ===================================HOX2a_HOX2a
                                                         <---------GATA12
                                                         --------->GATA12                      <----
                                                         <---------RVE1(2)               ------>ZmHOX2a(1)
                                                         <---------ARR14(2)             <---------ALFIN1
                                                         --------->ARR14(2)    <---------ARR14(2)
                                                         <---------ARR11(3)    <---------TOE1(2)
                                                <-------TEIL<----------DOF2    <-----------ARR10   -
                                               --------->CCA1(2)               ------->TEIL   <-----
                                               --------->ARR14(1)              <---------ARR11(1) --
                                              <---------RVE1(2)                --------->ARR14(2) <-
                                              --------->ARR11(1)               <---------ARR11(2)---
            ----------->RAV1(1)               <---------ARR11(2)               --------->ARR11(2)---
          --------->At4g35610                 --------->ARR11(2)              <---------CCA1(2)-----
      --------->ANAC58                        <---------ARR14(2)          <-----------HVH21 ------>ZmHOX2a(1)
      --------->ANAC46  --------->YAB1        --------->ARR14(2)         --------->DEAR3(1)<--------
      --------->ANAC58--------->ANAC58      ----------->ARR10         <---------ALFIN1------>ZmHOX2a(1)
 ------>ZmHOX2a(1)    --------->ANAC58  --------->GLK1(2)--------->ARR11(3)   <---------ARR14(1) <--
 
catcctcacaagcagcaacaagaacaagcacaacaacaagaagaagctagatacgaatgggatctttctctctccaccgtcgtatcttcctcctcctcct  8005400
    ------>NtERF2
   --------->DEAR3(1)                                                             <-----------GT1
   ----------->HVH21                                                       <-------TEIL
 ------>NtERF2                                                --------->GLK1(1)<---------DOF5.7(1)
 <---------ATERF1(1)                                       <------NtERF2  --------->ARR14(1)
--------->DEAR3(1)                                        ------>NtERF2  <---------GLK1(2)
-----ATERF1(1)                                            --------->LBD16--------->ARR14(2)
-------->ATERF1(1)                                       --------->LBD16 <---------ARR14(2)
----ALFIN1<---------DOF5.7(2)                           <---------LBD16  --------->ARR11(1)
---->NtERF2                                            ------>NtERF2 ---------->DOF2
--------ATERF1(1)                    --------->YAB1   --------->DEAR3(1)--------->KAN1
------>DEAR3(1)                      --------->YAB5   ------->GAMYB--------->ANAC58 <---------RAP2.6(2)
------>ANAC46                 --------->PCF2         --------->MYB46(3) <---------HSFB2a(1)
->ZmHOX2a(1)                  <------ZmHOX2a(2)      --------->DEAR3(2)--------->DOF5.7(1)        <-
-ALFIN1 --------->DOF5.7(2)  --------->GATA12       <---------ATERF1(1)----------->ARR10    <-------
-------ALFIN1                <---------GATA12    <---------DEAR3(2)--------->ANAC58<---------At5g28300
 
ccgcctccgacgttatcggagctattgaattcgatcccactgataacatcgtcgctaccgccgggatttcaagaaagattcgtttttacggcctcccttc  8005500
                                                       ----------->RAV1(2)
                                                      --------->ABI4(1)
                                                      ------>NtERF2
                              <---------HSFB2a(1)    <---------ALFIN1
                              --------->HSFB2a(1)    --------->DEAR3(1)
                              --------->HSFC1(2)     ------->GAMYB
                              <---------HSFC1(2)     --------->DREB2C(2)
                           --------->LBD16          --------->ORA47(2)
                         <---------LBD16            --------->MYB46(3)
                        --------->MYB52(1)          --------->DEAR4(2)
   <---------ANAC55(2)  --------->SPL7(1)           <------NtERF2
   --------->ANAC55(2) --------->ARR11(2)           --------->ATERF1(1)
   <---------ANAC58    <---------ARR11(2)          <---------ATERF1(1)
   --------->ANAC55(1) <---------ARR14(2)          ------>NtERF2
   --------->ANAC58    --------->ARR14(2)         --------->DEAR3(1)           <---------DEAR3(1)
   --------->ANAC46   <---------MYB52(1)         --------->MYB46(3)      --------->ZAT14
   --------->ANAC58   <---------SPL7(1)        --------->ANAC58      --------->GATA12
   <---------ANAC58  --------->LBD16           --------->ANAC46   <-----------GT1
  <---------TOE2(3) --------->ANAC46           --------->ANAC58<---------KAN1 <---------LBD16
---------DOF2      <---------LBD16           ---------->DOF2  --------->ARR14(2)------>NtERF2
--DOF5.7(1)    <-----------HVH21            <------ZmHOX2a(2) <---------ARR14(2)--------->LBD16   <-
 
tcttttacgtaacaacgctgtctccggtaccggagtttccttcgtcgatcaagccaccgcctgcgaatattacatctgtactccggcgaaacttagtagt  8005600
                     <-------GAMYB
                     <-----------HVH21                                ===================HOX2a_HOX2a
                    <---------MYB46(3)                            --------->SPL7(1)
                    <---------SPL7(1)                          <---------ANAC58                 ----
                    <---------DEAR3(2)                        <---------------AtSPL3  <---------LBD16
              --------->ALFIN1                                <---------------AtSPL8<---------DEAR3(1)
             <-----------HVH21                           <---------ZAT6       --------->DOF5.7(1)
             --------->ARR14(2)                          <---------YAB5------>ZmHOX2a(2)   ---------
           --------->LBD16                               --------->ICU4==================HOX2a_HOX2a
         <---------LBD16                              <------NtERF2   <------ZmHOX2a(2)   --------->KAN1
       <---------ARR14(2)                            --------->ZAT14 --------->GATA12 <------NtERF2
       --------->ARR14(2)   --------->ATHB12         <---------ZAT14 <---------GATA12------>NtERF2--
      <---------GLK1(1)     --------->KAN1        ------>NtERF2<---------ANAC58    --------->SPL7(1)
  --------->ALFIN1 <---------DEAR3(1)            <---------DEAR3(1)  --------->ARR11(3)  <---------MYB52(1)
--------->LBD16 <---------SPL7(1)     <------NtERF2<------NtERF2<---------SPL7(1) <------ZmHOX2a(1)
--------LBD16<---------ARR14(2)     --------->ETT(1)<---------ANAC46 <---------ARR11(3) --------->LBD16
 
ctccggtggagacccgggtcgggcggtcgggttattgggtcgggagattacgacggcgtagtgatggagtacgatcttgagaagaggacgccggtattcg  8005700
<- Previous    Next ->

AGI:  At5g23730.1   
Description:  nucleotide binding. similar to transducin family protein / WD-40 repeat family protein [Arabidopsis thaliana] (TAIR:AT5G52250.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO17233.1); contains InterPro domain WD40 repeat-like (InterPro:IPR011046); contains InterPro domain WD40/YVTN repeat-like (InterPro:IPR015943); contains InterPro domain WD40 repeat (InterPro:IPR001680)
Range:  from: 8005237    to: 8006633    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version