AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                       <---------TOE2(3)
                                    <---------WOX13(1)
                                   --------->WOX13(2)
                                   <---------WOX13(2)
                                  <---------AHL25(3)
                                 <---------AHL20(2)
                                 --------->AHL20(2)
                                 --------->AHL12(1)
                                 <---------AHL12(1)
                                 --------->AHL20(1)
                                 <---------AHL20(1)
                                 <---------AHL25(3)
                                 --------->AHL25(3)                                                -
                                 <---------AHL25(2)                                               <-
             <---------YAB1      --------->AHL25(1)        --------->ANAC58                       --
---------WOX13(1)                <---------AHL20(3)        --------->ANAC58 --------->YAB1     <----
--------WOX13(2)                --------->AHL12(2)      <---------RVE1(2)  <---------YAB5      -----
------->WOX13(2)                --------->AHL25(3)    <------MYB83 <---------TOE2(3)           <----
------YAB1   <---------TOE2(3) <---------WOX13(2)   <--------P  --------->ICU4<---------YAB1   -----
------AHL20(2)                 --------->WOX13(2) <---------MYB46(3)       <---------YAB1      <----
----->AHL20(2)               --------->AHL20(2)<-----------RAV1(1) <---------YAB1              -----
------AHL25(1)           ---------->DOF2<---------YAB1<------MYB46(1)    --------->YAB1        <----
----->AHL25(1) --------->ARR11(3)<---------AHL25(1)<-------GAMYB<---------ATHB51               -----
 
taattgatgacataataagatagtttcccaaagtaattaattgatgatatatgtggttggataagaaattatggtattatcatgtttgcctctcaaattt  6828600
          <---------AHL12(2)
         --------->AHL12(1)
         --------->YAB1
         <---------AHL12(1)
         --------->AHL25(1)
         <---------AHL25(1)
         --------->AHL20(2)
         --------->AHL20(3)
         <---------AHL20(3)
         <---------AHL12(3)
         <---------AHL20(2)
         --------->AHL12(3)
        <---------YAB5
       <---------AHL12(2)
       --------->WOX13(2)
       <---------WOX13(2)
      <---------AHL25(3)
     <---------AHL25(3)
     --------->AHL25(3)
     --------->AHL12(1)
     <---------AHL25(2)
     <---------AHL12(1)
     --------->AHL12(3)
     <---------AHL20(2)
     <---------AHL20(1)
     --------->AHL20(1)
     --------->AHL25(2)
     --------->AHL20(2)
     <---------AHL12(3)
     --------->AHL25(1)
     <---------AHL20(3)
     <---------AHL25(1)
     --------->AHL20(3)
    --------->AHL25(3)
   --------->AHL12(2)
   --------->WOX13(2)
   <---------WOX13(2)
 --------->AHL20(2)
 --------->AHL12(1)
 <---------AHL25(3)
 --------->AHL25(2)
 --------->AHL25(3)
 <---------AHL12(1)
 --------->AHL25(1)
 --------->AHL12(3)
 <---------AHL25(1)
 <---------AHL20(2)
 <---------AHL12(3)
--------->AHL20(2)                                                              <---------ARR11(3)
--------->AHL20(1)                                                              --------->ARR11(3)
<---------AHL20(1)                                                             --------->GLK1(1)
<---------AHL20(2)                                                             <---------GLK1(1)
--------->AHL12(3)                                                             <---------RVE1(1)
--------->AHL25(3)                                                            <---------ARR14(2)
<---------AHL25(3)                                                            <---------ARR11(3)
<---------AHL25(2)                                                            --------->ARR14(2)
--------->AHL25(2)                                                            --------->ARR11(3)
<---------AHL12(3)                                                          --------->LBD16
--------->AHL25(1)                                                         --------->HSFB2a(2)
<---------AHL25(1)                                                         <---------HSFB2a(2)
-------->AHL12(2)                                                      <----------DOF2
--------WOX13(2)                                                      <---------DOF5.7(1)
------->WOX13(2)                    ---------->DOF2                 <-----------GT1
-----AHL20(2)                      <---------AHL25(3)              <-----------GT1
---->AHL25(3)               ----------->GT1                       <---------AHL20(2)
-----AHL25(3)               <---------At4g35610                   <---------AHL25(3)
---->AHL12(3)               --------->At4g35610                  <---------AHL20(3)             <---
-----AHL12(3)              --------->ANAC58                      --------->AHL25(1)     <---------KAN1
---->AHL20(2)            <---------KAN1    <-----------GT1       <---------AHL25(1)   <---------GLK1(2)
-----AHL25(1)     <-------TEIL  <---------WOX13(2)               --------->AHL20(3)--------->HSFB2a(2)
---->AHL25(1) <-------TEIL --------->ANAC58<---------WRKY18(1)   --------->AHL20(2)<---------HSFB2a(2)
 
aaatttaattaattatatacatacacgagtaagctaaataaaagtttgaccacatttcatatgaagaattttatctttccagatatctagaatttgtttt  6828700
                                                             <-----------GT1
                                                    --------->ANAC58
                                                    --------->ANAC46
                                                    --------->ANAC58
                                                  <-----------GT1
                                                <---------AHL20(2)
                                                <---------AHL25(1)
         <---------WOX13(2)--------->ANAC58     --------->AHL20(2)
        --------->ATHB12   <---------ANAC55(2)--------->WOX13(2)    --------->YAB1
<---------REM1(2)          --------->ANAC58   <---------WOX13(2)  ------>MYB46(1)           --------
<---------ZAT14           <---------LBD16     --------->AHL12(2)  ------>MYB83         --------->RVE1(2)
--------->ZAT14         <---------SPL7(1)----------->GT1  <----------DOF2             --------->YAB5
--------GT1           <---------------AtSPL3  <---------AHL12(2)  <-----------HVH21<---------At4g35610
 
ctctacacagttcattgaagaaaacatagtacggaagagaccagaggttaattaaacgacactttaacctatcacgagagagactgagatgatcaaatca  6828800
                                                                               --------->ANAC55(2)
                                                                               <---------ANAC55(2)
                                                                               <---------ANAC58
                                                                             <-----------GT1
                                                                         --------->AHL20(1)
                                                                         <---------AHL20(2)
                       --------->ANAC58                                  <---------AHL20(1)
                       --------->AtLEC2                                  --------->AHL25(2)
                       --------->ANAC58                                  <---------AHL25(2)
                      <-------MYC3                                       <---------AHL25(3)
                   --------->YAB1                                        <---------AHL25(1)
                  <---------ATHB12                                       --------->AHL25(1)
             --------->TOE2(3)                        <---------TOE2(3)  --------->AHL20(2)
        --------->AHL20(2)               --------->ANAC58                --------->AHL25(3)
       --------->AHL12(2)       <---------ZAT6   --------->YAB5          --------->AHL20(3)
       <---------AHL12(2)   --------->DOF5.7(1)--------->RVE1(2)         <---------AHL20(3)
    --------->AHL20(2)------->MYC3   <---------WOX13(2)            <---------DAG2<---------MYB52(1)
---------->DOF2 --------->WOX13(1)   --------->WOX13(2)            <----------DOF2            ------
->RVE1(2)  <---------YAB5 ---------->DOF2--------->ANAC58       <-----------GT1<---------ANAC58
 
aatgaaagaaaataaacatcaatcacatgcaaagagtgttcattaagcaaaatcactaagtttgtttttactttattttattacgttacttcaagttttt  6828900
                       --------->DOF5.7(1)
                      --------->DOF5.7(1)
                      --------->DAG2
                     --------->DOF5.7(1)                              --------->ANAC58         -----
              ----------->GT1                                     --------->ANAC58           -------
 <-----------GT1     ---------->DOF2                              --------->ANAC58           -------
<-----------GT1--------->At5g28300        <---------------------WRI1  --------->ANAC58<---------ZAT18
--->AHL12(2)  <---------ZAT6----------->GT1   <---------ANAC46  ---------->DOF2----------->HVH21
 
tttttatcttcttggtactgtaaaaaaaggagagaaaatagagttggctatgtgtaataagcgaaccaaaagcaagccttccatgactgtgccctcaaga  6829000
                                                     --------->YAB1
   <----------DOF2                                --------->WOX13(1)
----->DOF2                                       <---------AHL12(1)                    <----------DOF2
-->ANAC58              <-----------HVH21      xxxxxxxxxxxxxxxxxx>smallRNA(se3)         --------->TOE2(3)
-->ANAC58 ------------>CBF---------->DOF2  *TSS  --------->AHL12(1)          <---------YAB1
 
aagtagctttgttttcaatcccaaactgtcaaagtctctcttcacctcaagattaatcaaaacatttctctctctatctcatcaatgttactttaaaacc  6829100
                                             <---------ARR11(3)
                                             <---------ARR14(2)
                                             --------->RVE1(2)
                                             --------->ARR14(2)
                                             --------->ARR11(3)
                                             <---------ARR11(1)
                                   ------>ZmHOX2a(1)
                               --------->ARR14(2)
                               --------->RVE1(2)
                               <---------ARR11(2)
                               --------->ARR11(2)
                               <---------ARR14(2)
                              <---------CCA1(2)         --------->AHL20(2)
                              --------->GLK1(1)   <-----------GT1
                              --------->KAN1 <-----------ARR10                    --------->DOF5.7(1)
     <---------DOF5.7(1)      <---------GLK1(1)--------->TOE2(3)                ---------->DOF2
    ------>ZmHOX2a(1)  <-----------GT1      <---------CCA1(2)       --------->TOE1(3)             --
   <---------ALFIN1    --------->ANAC46 ------>ZmHOX2a(1)           --------->TOE2(3)           ----
 
aatgctcctcttcttgttcttcatataaaccacatatcctctcctccatatcttaacaatttcatagcaaaccctaaaattgagaaagagatagagagag  6829200
                              <---------ARR11(2)
                         --------->DOF5.7(1)
                ====================HOX2a_HOX2a           --------->KAN1
                <------ZmHOX2a(2)                         <---------ANAC46
               --------->GATA12                         <---------TGA2(2)
               <---------ARR11(3)                    <---------MYB46(3)            <------MYB46(1)
               <---------GATA12              --------->MYB52(1)    --------->DOF5.7(1)
               --------->ARR11(3)            ----------->RAV1(1) ---------->DOF2   <------MYB83
             <---------HSFB2a(1)          --------->ANAC58<---------ANAC58        <---------MYB46(3)
             --------->DOF5.7(1)          --------->ANAC58<---------ANAC58       <---------WOX13(1)
          =============HOX2a_HOX2a    --------->ANAC58 ----------->HVH21  ==========================
          <------ZmHOX2a(1)   <---------ARR14(2)    --------->ALFIN1      <------ZmHOX2a(1)
------->DOF5.7(1)      ---------->DOF2--------->ANAC58 ----------->TGA1<------ZmHOX2a(1)        ----
------>DOF2---------->DOF2   <------ZmHOX2a(1)  ------->GAMYB  <---------HSFB2a(2)<---------AtMYB61
 
aaagatgggtagaggaaagatcgagataaagaggatagagaacgcaaacaacagagtggtgacgttctcaaagaggaggaatggattggtgaagaaggct  6829300
                                                                                         ------>ZmHOX2a(2)
                                                                                       <---------GATA12
                                                             --------->YAB5            --------->ARR11(3)
                                                    <---------YAB5                     ------->TEIL
                                               --------->ANAC58                        --------->GATA12
                                               --------->ANAC46  --------->YAB5        <---------AGP1
                                               --------->ANAC58<---------WOX13(1)      <---------ARR11(3)
                                              <---------------AGL15                    --------->ARR11(2)
                                              --------------->AGL15                    <---------RVE1(2)
                                             <---------AtLEC2--------->ATHB12          <---------ARR11(2)
                                             ----------------->AGL1                    <---------ARR14(2)
                   --------->AtLEC2          <-----------------AG--------->ATHB12      --------->ARR14(2)
   <------ZmHOX2a(2)                    <---------ICU4      <---------YAB1            <---------CCA1(2)
  --------->ARR11(3)                   <---------YAB5--------->YAB1               <---------AtLEC2
  <---------ARR11(3)    --------->DAG2--------->GLK1(2)   <---------At4g35610  =================HOX2a_HOX2a
==========HOX2a_HOX2a  ---------->DOF2<---------ARR11(3) --------->DOF5.7(1)   ------>ZmHOX2a(1)
------>DOF2 <----------DOF2       --------->YAB1  --------->MYB52(1)   <-----------RAV1(1)         <
 
aaagagatcacagttctttgtgatgcaaaagttgccctcataatctttgcaagtaatggtaagatgattgattactgttgtccttccatggatcttggtg  6829400
                                                                                                   <
                                                                                                   -
                                                                                                   -
                                                                                                   <
                                                                                                   -
                                                                                                   <
                                                                                                   -
                                                                                                   -
                                                                                                   <
                                                                                                   <
                                                                                                   <
                                                                         <---------AHL20(2)       --
                             --------->ANAC58                 <-----------GT1                     --
             --------->HSFB2a(2)                          <---------WOX13(2)   ---------->DOF2    --
             <---------HSFB2a(2)                      ----------->GT1<----------DOF2       ---------
-----------RAV1(1)           --------->ANAC58    --------->YAB1     <---------DOF5.7(1)<----------DOF2
 
ctatgttggaccaataccagaagttatctggcaagaaactatgggatgctaagcatgaggtaattttgctctctttttaatctaaagtttctttgtctca  6829500
<- Previous    Next ->

AGI:  At5g20240.1   
Description:  PI (PISTILLATA); DNA binding / transcription factor. Identical to Floral homeotic protein PISTILLATA (PI) [Arabidopsis Thaliana] (GB:P48007;GB:Q9SQ07;GB:Q9SQ08;GB:Q9SQ09;GB:Q9SQ10;GB:Q9SQ11;GB:Q9SQ12;GB:Q9SQ13); similar to TT16 (TRANSPARENT TESTA16), transcription factor [Arabidopsis thaliana] (TAIR:AT5G23260.1); similar to pistillata [Arabidopsis lyrata] (GB:AAF25591.1); contains InterPro domain Transcription factor, MADS-box; (InterPro:IPR002100); contains InterPro domain Transcription factor, K-box; (InterPro:IPR002487)
Range:  from: 6829044    to: 6831517    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version