AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                   <---------KAN1
                                                               ------>ZmHOX2a(2)
                                                            --------->ATHB12
                                                            -------->HAHB4
                                                       --------->AHL20(2)
                                                       --------->AHL25(2)
                                                       <---------AHL25(1)
                                                       <---------AHL20(2)
                                          ------>ZmHOX2a(2)<---------YAB5
        <---------DOF5.7(1)              <------ZmHOX2a(2) --------->ICU4              --------->AtMYB61
     --------->At4g35610                --------->ARR11(3) <---------YAB1             --------->MYB46(3)
     <---------At4g35610                <---------AGP1 <---------AHL20(3)           --------->AtMYB61
 --------->ANAC58           --------->AHL12(1)         --------->AHL25(1)          --------->MYB46(3)
 --------->ANAC46       ----------->GT1 <---------ARR11(3)<---------TOE2(3)<---------------AtSPL8
 --------->ANAC58       <---------YAB1  <---------GATA12  --------->WOX13(2)   --------->SPL7(1)
------>YAB1      <---------ARR11(3)     --------->AGP1--------->AHL12(2)   --------------->AtSPL8
--->AtSPL8       --------->ARR11(3)     --------->GATA12 --------->YAB1    <---------------AtSPL3
----AtSPL8     <---------YAB1     <---------YAB1      --------->YAB1    <---------RVE1(2)        <--
 
taacaagcagctcttatgaagatagtgatgaaaaattgttatagatctatcttggaattttaatgatcgaatttcgattttgtacgaccaccatcgaggc  5876800
                                                     <---------AHL20(2)
                                                     --------->AHL20(2)
                                                     <---------AHL20(3)
                                                     <---------AHL25(3)
                                                     --------->AHL25(1)
                                                     <---------AHL25(1)
                                                     --------->AHL25(2)
                                                     <---------AHL25(2)
                                                     --------->AHL20(1)
                                                <---------YAB1
                                              --------->YAB1
                                          --------->DOF5.7(1)
                                         <---------AHL25(2)            <---------WOX13(2)
                       <-------GAMYB     --------->AHL20(2)        --------->ANAC55(2)
                      <---------MYB46(3) <---------AHL25(1)        --------->ANAC46
                     --------->ALFIN1    <---------AHL12(3)        --------->ANAC58
      --------->AHL12(3)   <---------ANAC46   --------->YAB5       --------->ANAC55(1)
      <---------AHL20(3)  <---------At4g35610 ----------->GT1      <---------ANAC55(2)           ---
      --------->AHL20(3) <---------MYB46(3)  ----------->GT1       --------->ANAC58             ----
      <---------AHL12(3)<--------P       --------->AHL25(2) --------->ARR11(2)                  <---
----NtERF2 ----------->GT1--------->At4g35610<---------YAB1 <-----------GT1        --------->YAB5---
 
atcgactataaatatagttaaaatgtggttgctgaaaaaaaaaaaaaaatgataaataaaatgaaaccgcacgtaattgtataaaaccattagcatggga  5876900
                      --------->ZAT6
                    <-----------GT1
                 <---------WOX13(2)                                             ----------->GT1
     ----------->RAV1(1)                                                        <---------ANAC46
     <-----------------AGL1                                                     --------->ALFIN1
     --------->RAP2.6(2)                                                      <---------ANAC58
 --------->MYB59 --------->WOX13(2)           <----------DOF2                 <---------ANAC58
------>KAN1  ----------->GT1             --------->KAN1                       <---------ANAC46
----->ICU4   <------MYB83                <---------KAN1                    <---------AtMYB61
------YAB1  --------->MYB59      --------->ATHB12                    <---------ARR11(3)
------>ATHB12<------MYB46(1)    <---------AHL20(2)       <----------DOF2<----------DOF2     --------
 
ttattaggccacaatttggtaattaacacttgtaattcatttgaatatgcttttacaaaactttcccttcaatttcttttggtgtgtgaataaacagcta  5877000
                                                                     --------->AHL20(1)
                                                                     <---------AHL20(1)
                                                                    <---------AHL20(2)
                                                                    --------->AHL12(3)
                                                        <---------AHL12(1)
                                                        --------->KAN1 <---------AHL12(2)
                                                        --------->AHL12(1)
                                                       --------->AHL25(2)
                          --------->MYB46(3)           <---------AHL12(1)
                        <-----------GT1     <---------ICU4          <---------AHL12(3)      --------
                     --------->WOX13(2)    <---------YAB1       <---------------AGL15   <---------AHL25(1)
                     --------->AHL12(2)    <---------YAB5       --------------->AGL15   --------->AHL25(1)
                     <---------AHL12(2)  --------->YAB1--------->AHL12(1)               <---------AHL20(2)
                    <---------AHL20(2)   <---------ICU4<---------AHL25(2)               --------->AHL20(2)
                   --------->AHL20(2)   <---------YAB5 <---------ARR11(3)       <---------ANAC58
                 <---------WOX13(2)   --------->YAB1   --------->AHL20(1)       <---------ANAC58   <
                 --------->TOE2(3)  --------->ANAC58   --------->AHL20(3)      --------->ZAT2      -
               <-------TEIL         --------->ANAC58   <---------AHL20(3)      --------->STY1(2)  --
               ------->TEIL      <---------ZAT18       --------->ARR11(3)      <---------STY1(2) <--
           --------------->AtSPL8<---------ZAT14       <---------AHL20(1)  --------->WOX13(2) ------
->At4g35610<---------------AtSPL8--------->ZAT14      --------->AHL12(2)  <-----------GT1<---------AHL25(3)
 
tcaattttgtttttcatgtacattaaataaccactctgcactcatcatcattttctaaaatattcttctatatatattaactagcttgcaaataaatgta  5877100
                     --------->AHL25(1)
                     <---------AHL12(3)
                     <---------AHL20(2)
                     --------->AHL12(3)
                     <---------AHL25(1)
                     <---------AHL25(2)
                     <---------AHL25(3)
                     --------->AHL25(2)
                    --------->AHL12(3)
                    --------->AHL12(1)
                    <---------AHL25(1)
                    <---------AHL25(3)
                    --------->AHL25(2)
                    <---------AHL20(2)
                    --------->AHL25(3)
                   --------->AHL12(2)
                   <---------AHL12(2)
                 --------->AHL25(2)
                 --------->AHL20(2)
                 <---------AHL25(2)
                 --------->AHL25(1)
                 <---------AHL25(3)
                 --------->ATHB51
                 --------->AHL12(1)
                 <---------AHL12(1)
                 <--------ATHB1
                 <---------ICU4
                 <---------AHL20(1)
        --------->AHL20(3)
        --------->AHL12(3)
        <---------AHL20(3)
       <---------AHL25(3)
      --------->AHL25(1)
      <---------AHL25(1)
      <---------AHL12(3)
      --------->AHL12(3)
      --------->AHL25(3)
      --------->AHL20(2)
      <---------AHL20(2)         <---------KAN1
  --------->AHL20(2)<---------AHL25(2)
  --------->AHL12(3)--------->AHL25(1)
  <---------AHL12(3)--------->AHL20(2)
  <---------AHL20(3)<---------AHL12(1)
  --------->AHL20(3)<---------AHL20(1)
--------->AHL20(2)--------->AHL25(2)
--------->AHL20(3)--------->AHL12(3)
--------->AHL12(3)--------->AHL12(2)
<---------AHL12(3)<---------AHL12(3)
--------->AHL25(2)<---------AHL25(2)        ------>ZmHOX2a(1)                   <---------ZAT14
<---------AHL20(3)<---------AHL12(2)   <----------DOF2                          --------->ZAT14
--->GT1--------->AHL25(3)       --------->RVE1(2)                               <---------ZAT18
---------AHL25(3)--------->YAB1 --------->GLK1(2)                        --------->AtLEC2
-------->YAB1   <---------ATHB12<---------ARR14(2)                  --------->ANAC58
------->AHL20(2)--------->AHL25(3)    <---------DOF5.7(1)           --------->ANAC58        <-------
-------WOX13(2) <---------ATHB51<-----------ARR10                 ---------->DOF2         *TSS
--->AHL20(2)------------>CBF   <---------GLK1(2)             ----------->GT1    --------->ZAT18
 
aataaaaatataaatttcaataattttttttagagaatctctctttcctcttccaccatataaacagtgaaaagccattcaagtgctctctccctctatc  5877200
                                                                     <---------GATA12
                                                                     --------->AGP1
                                                                     <---------ARR11(3)
                                                                     <---------AGP1<------ZmHOX2a(1)
                                                                     --------->GATA12
                                                                     --------->RVE1(2)
                                                                     --------->ARR11(3)
                                                      <---------ARR14(2)          ----------->GT1
                                                      <-----------ARR10===================HOX2a_HOX2a
                                                      --------->ARR14(2)         --------->ANAC58
                                                      --------->RVE1(2)------>ZmHOX2a(2)
                       <---------MYB52(1)             --------->GATA12====================HOX2a_HOX2a
   --------------->AGL15                              <---------GATA12--------->CCA1(2)
   <---------------AGL15                        <---------GATA12   --------->DOF5.7(1)          ----
  <-----------------AGL3              --------->LBD16<---------CCA1(2)<------ZmHOX2a(2)<------------
  ==================================================================================================
--CCA1(2)             --------->TOE2(3)         ------->TEIL     ---------->DOF2 --------->ANAC58
 
tctcttctatttttagtttctcttcccttaatccctaaacccagaaacatgaatccaaatctccttgagaaagatctaagaggtaaggaaactacaaatg  5877300
                                        ------>MYB46(1)
                                        ------>MYB83
                                      <---------MYB46(2)
                                      <---------MYB111(2)
                                      <---------MYB111(1)
                                ------>ZmHOX2a(2)
                              <---------ARR11(3)
                              --------->RVE1(2)
                              <---------ARR14(2)
                              --------->GATA12
                              --------->AGP1              ----------->GT1
                              <---------AGP1            <---------ANAC46                           -
                              <---------GATA12      <---------ZAT2           -------->P   --------->HSFC1(1)
                   --------->ANAC58   <---------MYB59   <---------ANAC58    ------->GAMYB <---------HSFC1(1)
        <-------TEIL          --------->ARR11(3)    --------->At4g35610    <---------MYB55(2)      -
       --------->CCA1(2)      --------->ARR14(2)    <---------At4g35610    <---------MYB111(2)  ----
    <---------------AtSPL8   <---------At4g35610   <-----------RAV1(1)--------->ANAC58    --------->HSFB2a(2)
 <---------WOX13(2)--------->ANAC58  --------->ANAC46   <---------ANAC58   --------->MYB46(3) <-----
------->GT1    --------->ANAC58<------ZmHOX2a(2)--------->ANAC46      --------->ANAC58    <---------HSFB2a(2)
-----AGL3 ---------->DOF2    <---------CCA1(2)<---------ALFIN1        --------->ANAC46 --------->ZAT6
=====MADS_MADS --------->ANAC58--------->GLK1(1)<---------ALFIN1   --------->ZAT14  <---------CCA1(2)
 
ggtcaataagatacaaagaagcaaacaacttcagatctctaccaaactcacacactgctgcttgtaaaacttcactcaacaacccctctatctctagaaa  5877400
   --------->ANAC46                                                                         --------
  ------>ZmHOX2a(1)                                                                         --------
----->MYB46(1)                                                        --------->DOF5.7(1)  ---------
----->MYB83                                --------->TOE1(2)        ---------->DOF2 --------->ALFIN1
----->MYB46(3)                           ------->TEIL            <----------ID1   <---------KAN1
------GT1        --------->TOE2(3)  --------->At4g35610  ----------->GT1      <---------TOE2(3)    -
 
ccatcctcacaacaaatcagcctcagtcttggagtcggaagatgaacatgggaacgagagaggtgaaaacgaaaagagtttaagaatgaggggcaaaagt  5877500
                                                                                   <---------------AGL15
                                                                                   --------->ANAC46
                                                                                  <-----------------AGL3
                                                                                  ----------------->AGL3
                                                                                  ----------------->AGL1
                                      ------>MYB83                                <-----------------AGL1
                                      ------>MYB46(1)                        <------MYB46(1)
                              --------->ZAT14                                <------MYB83
                         <---------ZAT14                                    --------->MYB59
    --------->ZAT6       --------->ZAT18------->GAMYB                     <---------MYB52(1)
->DOF5.7(1)    --------->At4g35610   ----------->RAV1(1)             ----------------->AGL1
->DAG2         <---------At4g35610   --------->MYB52(1)              <-----------------AGL1
->DOF2  ---------->DOF2 <------ZmHOX2a(1)                     <---------ANAC58    ----------------->AGL2
-------->WOX13(2)   <---------O2    --------->AtMYB61         <---------ANAC58 --------->PCF5
 
ggaattaacacaaaagtatgctcacgaggacactggagaccaacagaagatgctaaactcaaggagcttgttgcccagtttggtccccaaaactggaact  5877600
                                                              --------->ATHB51
                                                              --------->AHL20(2)
                                                              <---------AHL20(2)
                                                              <---------ICU4
                                                              <---------AHL12(1)
                                                              --------->AHL25(1)
                                                              <---------AHL25(1)
                                 <---------AHL25(1)           --------->AHL12(1)
                                 <---------AHL20(2)           --------->AHL12(3)
                                 --------->AHL20(2)           <---------AHL25(3)
                                 --------->AHL12(3)          <---------YAB5
                        --------->MYB59                      --------->AHL25(3)
                      <------ZmHOX2a(2)                      --------->ICU4
                     <---------RVE1(2)                      --------->WOX13(2)
                     --------->ARR11(3)                     --------->AHL12(2)
                     <---------AGP1--------->WOX13(2)       <---------WOX13(2)
                  <--------P     --------->AHL25(1)       <---------AHL12(1)
          <---------DOF5.7(1)   --------->AHL25(3)        --------->AHL12(1)
       ------->GAMYB <---------GATA12                     <---------AHL20(2)                     <--
       <---------ALFIN1<-----------RAV1(2)                --------->AHL20(2)                 -------
      <---------MYB111(2)   <-------TEIL                <---------ANAC55(2)                 <-------
      <---------MYB55(2)<---------------AtSPL8          --------->ANAC55(2)            --------->KAN1
      --------->MYB46(3)<---------------AtSPL3    <---------YAB1          <----------DOF2  <--------
    <-----------GT1  --------->GATA12 <-----------GT1 <-----------GT1     <---------DAG2 --------->ARR14(2)
 
tgatttctaaccaccttcttggtagatcaggtacatttattttacttaaaattcttattacttaattatttccttcacttttgttactccaaattccgca  5877700
<- Previous    Next ->

AGI:  At5g17800.1   
Description:  AtMYB56 (myb domain protein 56); DNA binding / transcription factor. similar to MYB117 (myb domain protein 117), transcription factor [Arabidopsis thaliana] (TAIR:AT1G26780.1); similar to MYB105 (myb domain protein 105), DNA binding / transcription factor [Arabidopsis thaliana] (TAIR:AT1G69560.1); similar to putative transcription factor [Oryza sativa (japonica cultivar-group)] (GB:BAD81105.1); similar to hypothetical protein OsJ_001233 [Oryza sativa (japonica cultivar-group)] (GB:EAZ11408.1); contains InterPro domain Myb transcription factor (InterPro:IPR015495); contains InterPro domain Homeodomain-related; (InterPro:IPR012287); contains In
Range:  from: 5877191    to: 5879333    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version