AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                             ------>ZmHOX2a(1)
                            --------->TOE1(3)                --------->DOF5.7(1)
                        <---------GLK1(2)                   --------->DOF5.7(1)
                  <------ZmHOX2a(2)                    <---------WOX13(2)
                  ==================HOX2a_HOX2a        <-----------------AGL1
                 <---------GATA12                   --------->At5g28300  <------NtERF2
                 <---------ARR11(3)                 --------->DOF5.7(2) <---------MYB46(3)
                 --------->ARR11(3)                ----------->GT1     --------->ALFIN1
           ------>ZmHOX2a(1)--------->TOE2(3)   --------->GLK1(2)      <---------ANAC46  <-------TEIL
  --------->TOE2(3)    --------->KAN1       --------->YAB1 ---------->DOF2           >>>>>>>>>MYB98
->HSFB2a(2)==============HOX2a_HOX2a      --------->AtLEC2 --------->DOF5.7(1)   ----------->GT1  --
 
ccatttcttaattcctcacagatcatagattccttaagacaattcattcaaaatcggtaactaaaagggaaatggtggggagattagtaacatacagtga  4702700
                                                <---------ARR11(3)
                                                --------->ARR11(3)
                                      --------->ZAT6
                                  <---------MYB52(2)                          ------->GAMYB
                     <------MYB83--------->ANAC58                           --------->At4g35610
                     <------MYB46(1)--------->MYB52(1)                    <---------KAN1
               <---------ANAC58  --------->ANAC58                         --------->MYB46(3)
           --------->LBD16       --------->ANAC55(1)             --------->AtLEC2         ----------
--------->GT1  <---------ANAC58  --------->ANAC46  <----------DOF2   ------>NtERF2 --------->YAB5
 
gaggtaagaagtcccgaggcgagtcggtcttagcacaagtaacagtagagagaactttggtctcgtccatgccgagaacaactgaaccattagcaaagcg  4702800
                                 ======================HOX2a_HOX2a
                                 ------>ZmHOX2a(2)
                                 =========================HOX2a_HOX2a
                                =======================HOX2a_HOX2a
                                <------ZmHOX2a(2)
                                ==========================HOX2a_HOX2a
                               --------->GATA12
                               --------->ARR11(2)
                               <---------ARR14(2)
                               --------->ARR14(2)        <---------ICU4
                               <---------ARR11(2)        --------->ATHB12         ----------->HVH21
                               <---------GATA12          -------->HAHB4         --------->LBD16
                            --------->LBD16              --------->YAB5        <---------ANAC46
                          <---------LBD16               <---------ATHB12      <---------LBD16
                          <-------MYC3             ------>ZmHOX2a(1)         ------>ZmHOX2a(1) -----
                          ------->MYC3            --------->TOE2(3)      --------->ARR11(2)    <----
    <-----------GT1      --------->ANAC46       ------>ZmHOX2a(1)        <---------ARR11(2) --------
  <---------DOF5.7(1)    <---------O2       <---------KAN1        --------->AHL25(2)        <-------
>DOF2<-----------GT1     --------->O2      <---------GLK1(1)      <---------AHL25(2) --------->DEAR3(2)
 
agcgatttttccagtctcaaacgagaccacgcgggatccgacttcgaattcctccttaaatgattccaaaattttggttcctgcggagaccggcgagtct  4702900
                             <-----------RAV1(2)
                            --------->At4g35610
                            <---------At4g35610
                          <------NtERF2
                         --------->LBD16
                         <------NtERF2
                        <---------DEAR3(1)
                       --------->SPL7(1)
                       <---------LBD16
                       --------->ATERF1(1)
                      ------>NtERF2                       --------->AtLEC2
                      --------->ATERF1(1)            --------->ANAC58
                      <------NtERF2                  --------->ANAC46
                      <---------ATERF1(1)            --------->ANAC58
                     <---------SPL7(1)            <---------ZAT14               --------->At4g35610
    --------->ANAC46 <---------ATERF1(1)          --------->ZAT14               <---------At4g35610
  --------->MYB52(1) <---------RAP2.3(1)       --------->LBD16                 --------->GLK1(2)
--------->MYB46(3)   ------>NtERF2  <---------ANAC46--------->ZAT18     <------ZmHOX2a(1)
--------->DEAR3(2)  <---------RAP2.3(2)  <---------ARR14(2)           --------->MYB59
---->HSFB2a(2)      <---------DEAR3(1)   --------->ARR11(2)         --------->ICU4
-----HSFB2a(2)      <---------RAP2.6(2)  --------->ARR14(2)        <---------WOX13(2)
->GLK1(2)          --------->RAP2.6(3)   <---------ARR11(2)     <------ZmHOX2a(1)        --------->STY1(2)
--ARR14(2)  <---------ARR11(2)   --------->ALFIN1 <---------ZAT18  --------->WOX13(2)    <---------STY1(2)
 
ggaacagacggagcgaaaccaaggcggccggagcagatggtgcgaaaccccagagcacgccatgcgaggaaattaggaagagaagctgaactagctcgat  4703000
                                                                                        <---------TGA1a
                                                                                        <---------ANAC46
                                                                                        ============
                                                                                ------->TEIL
                                                                             --------->ANAC46
                                                                             --------->ANAC58
                                                                    --------->DOF5.7(1) ============
                                                                   --------->DAG2   <-----------HVH21
                                                                   --------->DOF5.7(1)*TSS
                                                                  --------->DOF5.7(1) --------->ZAT14
                                              --------->DOF5.7(1) ---------->DOF2  --------->LBD16
                                         --------->LBD16          ================================bZIP_DOF
                   <-------TEIL         <---------ANAC46      --------->ANAC58  --------->MYB52(1)
         --------->TGA2(1)             <---------LBD16        --------->ANAC58------->GAMYB
         --------->bZIP60(1)           <-------TEIL         --------->MYB52(1)====================MYC_MYB
         <---------TGA2(1)          --------->KAN1       --------->YAB1      --------->ANAC58 <-----
         <---------bZIP60(1)        --------->CCA1(2)    --------->YAB5    <-----------GT1--------->ALFIN1
      ----------->HVH21            <---------RVE1(2)    <---------KAN1----------->GT1 <---------ZAT14
 
tcacaatcgatgacatcacacatacacagagagagtgagagatgcggagaagagagggaatgagaacggaaaagggtttaacgcaccggtgaagtgagga  4703100
         ------->GAMYB
   ------>NtERF2                                        --------->ARR11(2)
   <---------RAP2.6(3)                                  <---------ARR11(2)
  --------->DREB2C(2)                                   --------->ARR14(2)
  --------->DEAR3(1)                             <---------DEAR3(2)
  ----------->HVH21                              <------MYB83
  <---------ETT(1)                               <------MYB46(1)    --------->KAN1              ----
  --------->RAP2.3(3)                           --------->MYB59     <---------AHL20(2)         -----
  --------->RAP2.3(2)                           <---------------AtSPL3                         -----
  --------->RAP2.6(2)                           --------------->AtSPL3                         -----
 --------->RAP2.3(1)                            --------->MYB46(2)  --------->AHL12(1)      --------
 --------->DEAR3(2)                             --------->MYB52(2)  <---------AHL12(1)     ---------
--------->At4g35610                           <---------ARR11(2)  --------->AHL12(2)    ---------->DOF2
<---------At4g35610 --------->DOF5.7(1)       --------->ARR11(2)----------->TBP     --------->YAB5
=================MYC_MYB       <---------At4g35610<---------SPL7(1)<---------AHL12(2)--------->TOE2(3)
============================bZIP_DOF  --------->LBD16   <---------ARR14(2)    <-----------GT1<------
-ZmHOX2a(1)      ---------->DOF2     <---------LBD16--------->SPL7(1)       <---------KAN1 ---------
 
ctgagccgacaacgaaaactaaaagaagggttttagcagtcccggtctggttcggtacggttctgctataaataatcgaatttacaaacattaaaccgac  4703200
     ------>ZmHOX2a(2)
    <---------GLK1(1)
   --------->ARR11(3)
   <---------ARR11(3)
  --------->YAB1
-->NtERF2                                                                     ------>MYB83
---->DEAR3(1)         <---------RVE1(2)                                       ------>MYB46(1)
---->ANAC58         <---------YAB1                                          <---------MYB111(2)
---->ANAC58     --------->GATA12                                            <---------MYB111(1)
->DEAR3(1)      <---------GLK1(2)                                     <-----------GT1
>MYB46(3)       --------->ARR11(3)                    <-------TEIL   <---------AHL20(2)          <--
---ATERF1(1)    <---------RVE1(2)                    <---------MYB52(1)<-----------GT1 --------->ANAC58
>DEAR3(2)       <---------GATA12               <---------ZAT14      --------->YAB1     --------->ANAC58
 
gcctatgatctctgttttagattttgattcttggacaaaatttcttcaagtataccgttcattttcaacaattttaacacctacttaacccagcaaaact  4703300
                                                                                                  --
                                                                                             <------
                                                                                             -------
                                                                                             -------
                                                                                             <------
                                                                                             <------
                                                                                             -------
                                                                                             <------
                                                                                             <------
                                                                                             -------
                                                                                            --------
                                                                                            --------
                                                     --------->ANAC55(2)                    --------
                                                     --------->ANAC58                       --------
                                                     --------->ANAC58              <---------AHL12(1)
                                                     --------->ANAC46              --------->AHL25(2)
                                                     <---------ANAC55(2)           --------->AHL12(1)
                                                   --------->CCA1(2)         --------->ANAC58<------
                                                  --------->ARR14(2)         --------->ANAC58-------
                     <----------DOF2              <---------ARR11(2)        --------->WOX13(1)   ---
                     <---------DAG2               <---------RVE1(2)      <-----------HVH21  <-------
      --------->ARR14(2)                          <---------ARR14(2)--------->ARR14(2)      <-------
      <---------ARR14(2)                          --------->ARR11(2)<---------RVE1(2)       --------
      <---------GATA12               --------->AHL20(2)             <---------ARR11(3)      <-------
      --------->GATA12<---------DOF5.7(1)   <---------ZAT6          <---------ARR14(2)      <-------
-------RVE1(2) --------->YAB1  ------->TEIL <-----------RAV1(1)     --------->ARR11(3)  --------->AHL20(2)
 
gatattgcaaatcgccattgatcactttttagtgtatgtataaattagtgttggatacgaaactgaaaacagatattgtcactcaaatttttaaaataaa  4703400
                                                            <---------YAB1
                                                           <---------AHL20(2)
                                                           <---------AHL20(1)
                                                           --------->AHL25(2)
        --------->ANAC58                                   --------->AHL12(3)
        --------->ANAC58                                   --------->AHL12(2)
    --------->WOX13(2)                                     <---------AHL20(3)
    <---------WOX13(2)                                     --------->AHL20(3)
    <---------AHL12(2)                                     <---------AHL25(2)
  --------->ICU4                                         <---------YAB1
  --------->AHL12(1)                                     <---------AHL25(2)
  <---------AHL12(1)                                     --------->AHL25(3)
--------->GT1                                            --------->AHL12(3)
---AHL25(1)                                              <---------AHL20(2)
-->AHL25(1)                                              <---------AHL12(3)
-->AHL25(2)                                              --------->AHL25(1)
---AHL25(2)                        --------->AHL12(1)    --------->AHL25(2)
---AHL20(2)                        <---------AHL12(1)    <---------AHL25(1)
-->AHL12(1)                       --------->AHL20(3)    --------->AHL25(2)
---AHL25(3)                       <---------ARR11(3)    <---------AHL25(2)                         -
---AHL12(1)                       <---------AHL20(1)    --------->AHL20(2)                         -
-->AHL20(1)                       --------->AHL20(1)    --------->AHL20(3)            <---------ICU4
->AHL25(3)                        --------->AHL25(2)    <---------AHL20(3)            --------->ATHB12
->AHL12(3)                    --------->YAB1      --------->LBD16                     --------->ATHB51
->AHL12(1)                    ------->GAMYB      --------->ANAC46                     -------->ATHB1
->AHL25(1)                    --------->TOE2(3)  --------->ANAC58                    <---------YAB5<
---AHL20(1)                  --------->MYB46(3)  --------->ANAC58                    --------->ICU4<
-->AHL20(2)                 ------>MYB83        <---------LBD16                      <---------ATHB51
-------->GT1                ------>MYB46(1)  <-----------GT1<---------AHL12(2)   <---------YAB1    <
--AHL25(1)                  -------->P<---------YAB5    <---------AHL20(1)  <------MYB46(1)        -
--AHL12(1)             <-----------GT1<-------TEIL------>NtERF2             <------MYB83   <--------
->AHL20(2)       --------->YAB5   <---------AHL20(3)    --------->AHL12(2)<---------ANAC46 <--------
--AHL20(2)       --------->TOE2(3)<---------AHL12(1)    --------->YAB1 <-----------RAV1(1) <--------
--AHL12(3)      ----------->GT1   <---------AHL25(2)  --------->ICU4 <---------ANAC46--------->AHL12(1)
 
ttggaaaaattaagcaaaaacgtttatttccaaccaaaatattcatataaacccgccaatattatttttgttttgtgttgggttatgaattattgcgagc  4703500
<---------AHL12(2)                                                                                --
<---------YAB1                                                                                   <--
-------->AHL12(2)             <-----------HVH21                                                  <--
-------->AHL25(2)           <---------YAB5                                                       <--
---------AHL20(3)        <------ZmHOX2a(1)                                                       <--
---------AHL20(1)      --------->LBD16                                                           ---
---------AHL25(2)      <---------TOE1(2)         <----------DOF2                          ------->TEIL
-------->AHL20(3)     <---------LBD16         <---------ARR11(3)                       <---------ATHB12
-ANAC58              <---------LBD16      <------ZmHOX2a(1)                           --------->WOX13(2)
-ANAC58              ----------------->AGL1   --------->ARR11(3)             --------->At4g35610 <--
-ANAC46              <-----------------AGL1  <---------At4g35610 <---------RVE1(2)   --------->WOX13(1)
 
attatttttgtattgttcccaattcccaggaatggtcagacaagaggaagctctttgaactgtgttttgagcttggaggctactgcatcaatgaactctt  4703600
<- Previous    Next ->

AGI:  At5g14580.1   
Description:  polyribonucleotide nucleotidyltransferase, putative. similar to RIF10 (RESISTANT TO INHIBITION WITH FSM 10), 3'-5'-exoribonuclease/ RNA binding / nucleic acid binding [Arabidopsis thaliana] (TAIR:AT3G03710.1); similar to hypothetical protein OsI_007938 [Oryza sativa (indica cultivar-group)] (GB:EAY86705.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO14733.1); similar to putative polyribonucleotide nucleotidyltransferase [Oryza sativa (japonica cultivar-group)] (GB:BAD21450.1); contains InterPro domain Polyribonucleotide nucleotidyltransferase; (InterPro:IPR012162); contains InterPro domain K Homology; (InterPro:IPR004087); con
Range:  from: 4697243    to: 4703087    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At5g14590.1   
Description:  isocitrate dehydrogenase, putative / NADP+ isocitrate dehydrogenase, putative. similar to ICDH, isocitrate dehydrogenase (NADP+) [Arabidopsis thaliana] (TAIR:AT1G54340.1); similar to isocitrate dehydrogenase, putative / NADP+ isocitrate dehydrogenase, putative [Arabidopsis thaliana] (TAIR:AT1G65930.1); similar to NADP-specific isocitrate dehydrogenase [Lupinus albus] (GB:BAC77065.1); similar to isocitrate dehydrogenase (NADP+) [Nicotiana tabacum] (GB:CAA65504.1); similar to isocitrate dehydrogenase (NADP+) [Nicotiana tabacum] (GB:CAA65503.1); contains InterPro domain Isocitrate dehydrogenase NADP-dependent, eukaryotic; (InterPro:IPR004790); c
Range:  from: 4703301    to: 4706741    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version