AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                       <-------TEIL
                    <---------AHL12(1)
                   <---------AHL25(3)
                   --------->AHL25(2)
                   <---------AHL25(2)
                   <---------AHL12(2)
                   <---------AHL12(1)
                   --------->AHL12(3)
                   <---------AHL25(1)
                   --------->AHL12(1)
                  --------->AHL12(3)
                  --------->AHL25(1)
                  <---------AHL25(1)
                  <---------AHL12(3)
                  --------->AHL25(2)            <-------TEIL
                  --------->AHL25(3)           --------->CCA1(2)
                  --------->AHL20(2)          --------->ARR11(3)
          --------->YAB1                      --------->ARR11(1)
         <---------ATHB12            --------->At5g28300
        --------->RVE1(2)          <-----------------------TaNAC69(2)
       --------->WOX13(1)  --------->ZAT6   --------->DOF5.7(1)       --------->DOF5.7(1)
   <---------GATA12--------->AHL25(1)--------->LBD16                --------->DOF5.7(1)           --
   --------->RVE1(2)--------->AHL12(1)    ---------->DOF2           ---------->DOF2          -------
-->MYB46(3)       <---------AHL25(2)----------->GT1            XXXXXXXXXXXXXXXXXXX>MIR156H   -------
 
attcaaaatccaatcaaaaaaaaaaattcatcactaaaaccgtgaaaaagatacagactccaactacaaaaaaaagagagcaattttagggctatgaagc  4053100
                                       <---------O2
                                       --------->TGA1a
                                       <---------TGA1a
                                 --------->RVE1(2)
                                 --------->ARR11(3)
                                 <---------ARR11(3)
                                 <---------GATA12
                                <---------GLK1(2)
        --------->AtLEC2   ----------->RAV1(1)                                  --------->KAN1
        --------->ANAC58  <----------ID1              --------->ZAT6       --------->ANAC58
        --------->ANAC58--------->ANAC58          <---------KAN1           --------->ANAC58---------
------->AtLEC2          --------->ANAC58     --------->HSFB2a(2)  ------>MYB83  --------->ICU4<-----
-->ANAC58             ---------->DOF2  --------->O2 <-----------GT1        ----------->GT1<---------GLK1(2)
-->ANAC58             ===========================bZIP_DOF         ------>MYB46(1)        --------->KAN1
 
aatgcagaagcatgcaaaaatatgagaaagcaccaaaatctcacatgtctcgaatttacactctaaacctacataagctcgtaatattcaagagattctt  4053200
             --------->AHL20(3)
             <---------AHL25(1)
             --------->AHL20(2)
             --------->AHL12(1)
             <---------AHL12(1)
             --------->AHL25(1)                                                                 <---
   ------->PIF5                                                           --------->MYB52(1)    ----
   <-------PIF5                                                           >>>>>>>>>>>>>>>>>LFY  ----
  ----------->RAV1(2)                                          --------->AHL25(1)          ---------
  --------->ZAT2                                               <---------AHL12(1)          <--------
  <---------ZAT2                                               <---------AHL20(3)          <--------
  --------->At4g35610        --------->ANAC46                  <---------AHL20(2)          ---------
  <---------At4g35610        --------->ANAC58                  <---------AHL25(1)          ---------
 ------>NtERF2               --------->ANAC58                  --------->AHL25(2)          <--------
<---------ALFIN1<-----------GT1                                <---------AHL25(2)        --------->ANAC46
>GLK1(2)     --------->AHL25(2)                                --------->AHL12(1)       <---------At5g28300
-----DOF2    <---------AHL25(2)            --------->YAB1 ----------->GT1 <<<<<<<<<<<<<<<<<LFY  <---
 
tagccacctgcatcaattttttcaatcccttcacgaattctagcaaacaaaatttcaaaaacagaaaaaattgaacataccagtggaaattcacagcaga  4053300
                                                                 <---------AHL20(2)
                                                                 <---------AHL25(1)
                                                                 <---------AHL25(3)
                                                                --------->AHL25(3)
                                                                --------->AHL20(3)
                                                                --------->AHL25(2)
  <----------DOF2                                               <---------AHL25(2)
 <---------DOF5.7(1)                                            <---------AHL25(1)
------ZAT14                                                     --------->AHL25(1)
----->ZAT18                                                     <---------AHL20(2)
----->ZAT14                                                     --------->AHL20(2)
>ZAT2                                                           <---------AHL20(3)
-ZAT14                               <---------HSFB2a(2) <---------ANAC46  <---------YAB1
-At4g35610                           --------->HSFB2a(2) --------->At4g35610
>At4g35610                        <----------DOF2        ----------->GT1 --------->YAB1
>ZAT14                         --------------->AGL15----------->RAV1(2) <------ZmHOX2a(2)         --
-ZAT2                       <-----------GT1     --------->DOF5.7(1) <---------YAB5         ---------
------ZAT18------->GAMYB--------->YAB5   --------->GLK1(1)    <---------WOX13(2)      ----------->GT1
 
gcactcttttgcaatcgccttcgaagaagattaacttctttcagaaatcaaaaaaccctgaggtgaatttaatcgatcacgattttgcagagtttaaaga  4053400
                                                                                             <------ZmHOX2a(1)
                                                                                         <------NtERF2
                    --------->AHL12(1)                                                  ------>NtERF2
                    <---------AHL12(1)                                                  <---------RAP2.6(3)
                   <---------AHL12(2)                                                  --------->RAP2.6(2)
                   <---------AHL25(1)                                                  --------->ATERF1(2)
                   --------->AHL20(2)                                                  <---------ATERF1(2)
                   --------->AHL25(2)                                                 <---------LBD16
   <---------AHL12(1)                                                                <---------At4g35610
   --------->AHL25(1)                                                                --------->ZAT2
   --------->AHL25(2)                                                                --------->At4g35610
   <---------AHL25(2)       --------->GLK1(2)                                        <---------ZAT2
   <---------AHL20(3)       --------->RVE1(2)                                      --------->MYB46(3)
   --------->AHL12(1)      <---------GLK1(2)                    --------->GLK1(2)----------->RAV1(1)
   <---------AHL20(2)   --------->YAB1               <------MYB46(1)             <-----------HVH21
   <---------AHL25(1) --------->RVE1(2)              <------MYB83               --------->ANAC46
--------->GT1      --------->AHL12(3)<---------ARR11(2)     <------ZmHOX2a(1)   ----------->HVH21
->DOF2            --------->AHL12(2) --------->ARR11(2)<---------REM1(1)        <---------ETT(1) ---
 
gaagaaaaaattgaccttgaaaaaaaatcagaatcgaacagaaccagagaagaagttggtgaaggagaatcgattcagaaaacccgacagccggcaggaa  4053500
                                                                                                   <
                                                                                                   -
                                                                                                   -
                                                                                                   -
                                                                                                   <
                                                                                                   -
                                                                                                   <
                                                                                                   -
                                                                                                   -
                                                            ---------->ID1                         <
                                                           <-----------GT1                         <
                                                        <---------KAN1                             <
                                                       <---------ARR14(2)                          -
                                                       <---------RVE1(2)                           <
                 ----------->GT1                   <---------LBD16                                <-
                --------->DAG2                --------->GATA12                                    --
                --------->DOF5.7(1)           <---------GATA12<----------DOF2                <------
      <---------ANAC58                        <---------GLK1(2)               <---------TOE2(3)<----
      <---------ANAC58                        <---------ARR11(3)          <------------CBF   -------
      <---------ANAC46                        --------->ARR11(3)         <---------GLK1(2)   -------
-------->GT1   ---------->DOF2      *TSS      <---------RVE1(2)<---------DOF5.7(1)     <---------RVE1(2)
 
tggagaatttcgtagaagaaaagtgaaattgggcgagaagaaaaccctagattttggggatttttcttttttgccagaattgtggtttttgatattaagt  4053600
 <------------CBF
--------->ATHB12
<---------AHL25(3)
<---------AHL20(2)
---------AHL20(1)
-------->AHL20(1)
-------->AHL25(1)
-------->AHL20(3)
---------AHL20(2)
-------->AHL20(2)
---------AHL25(1)
-------->AHL25(2)
-------->AHL12(1)                                                                             ======
---------AHL12(1)                         ------->TEIL                               ----------->GT1
---------AHL25(3)                    --------->YAB5                              ---------->DOF2
---------AHL25(2)                   <---------YAB1                               ===================
-------->AHL25(3)                   --------->ICU4                     --------->RVE1(2)      <-----
---------AHL20(3)                 --------->YAB5                       <---------ARR11(3)  ---------
--------AHL12(2)                  --------->YAB1              --------->CCA1(2)--------->ANAC58
------->AHL12(2)                 --------->ICU4              --------->GATA12  --------->ANAC58
---ANAC55(2)                   --------->YAB1                <---------GATA12  --------->ANAC46    <
-----AHL20(2)          ----------->GT1 <---------YAB1--------->DOF5.7(1)<------ZmHOX2a(2)  ---------
-->ANAC55(2)       <---------ZAT6<---------YAB1    ---------->DOF2     --------->ARR11(3)  <--------
---->GT1 --------->RVE1(2)     --------->YAB5    --------->ANAC46 <---------RVE1(2)----------->GT1<-
 
aatttattgaaaaatcgaaatagagtaagttatatgatgatgatgaatttacacaaaagaccgagatttgataagatcacttacgaaagtgaaaaatctt  4053700
                                             --------->HSFB2a(1)
                                             <------ZmHOX2a(2)
                                             <---------HSFB2a(1)
                                            <---------GATA12
                                            --------->GATA12
        <---------ANAC58                    --------->ARR11(3)
       <------NtERF2                        <---------ARR11(2)
     --------->ALFIN1                       <---------RVE1(2)
    ------->MYC3                            --------->ARR14(2)
    <-------MYC4                      <------ZmHOX2a(2)
    <-------MYC3                     <---------ARR14(3)
    <-------MYC2                     <---------ARR14(2)
    ------->MYC2                     --------->ARR11(2)
    ------->MYC4                     --------->ARR14(2)
    <-------PIF5                     <---------ARR11(3)
    ------->PIF5                     --------->ARR14(3)
   ===================bZIP_DOF       --------->ARR11(3)
   >>>>>>>>>>HY5                     <---------ARR11(2)
   ===================bZIP_DOF       <---------GATA12      --------->bZIP60(1)
   --------->TGA1a                   --------->AGP1        <---------bZIP60(1)
   <---------PIF3(3)                 <---------AGP1       <---------TOE2(3)
   --------->PIF3(3)                 --------->RVE1(2)   <---------TGA2(2)
   <---------TGA1a                   --------->GATA12 --------->ZAT2
   --------->O2     --------->KAN1   <---------RVE1(2)<---------At4g35610
   <<<<<<<<<<HY5   --------->DOF5.7(1)--------->CCA1(2) ----------->HVH21
   <---------O2  ---------->DOF2    <---------KAN1    ----------->RAV1(2)
   <---------bZIP60(2)              <---------CCA1(2) --------->At4g35610
   --------->bZIP60(2)             ----------->ARR10 --------->LBD16             <---------WOX13(2)
=============bZIP_DOF          <-------PIF4 <---------ARR14(2)                 --------->AHL25(3)
=============bZIP_DOF          ------->PIF4 <-----------ARR10--------->DOF5.7(2) --------->WOX13(2)
-----DOF2  <----------DOF2     --------->ZAT18       ------>NtERF2  <---------TOE2(2)
>ARR11(3)<---------ZAT18   <------NtERF2    --------->ARR11(2)   --------->YAB1<---------AHL20(2)
----------------PIF3(2)    <---------At4g35610     <---------LBD16  <---------TOE1(2)
>GLK1(2)<---------ANAC58   --------->At4g35610------>ZmHOX2a(2) <---------YAB5 --------->AHL20(2)
-ARR11(3)--------->ZAT18  ------>NtERF2------>ZmHOX2a(2)----------->TGA1<-------TEIL
----------GT1  <---------YAB1<---------ZAT18<---------ARR11(3)  <---------YAB1--------->AHL25(3)
 
tttgccacgtggcgctctatgaaagatgccagcgcgcgcagatctgggatcttctccggctgacgttatcataggttcatttttaatttgttttgttttt  4053800
                   <---------AHL12(2)
                   --------->AHL12(2)
                  --------->AHL20(2)
                  <---------AHL25(3)
                  --------->AHL25(3)
                  <---------AHL20(2)
                  --------->AHL20(1)
                  <---------AHL20(1)
                  --------->AHL12(3)
                  <---------AHL12(3)
                  <---------AHL25(2)
                  --------->AHL25(2)
                  <---------AHL25(1)
                  --------->AHL25(1)
                 <---------AHL12(3)
                 --------->AHL20(2)
                 --------->AHL25(3)
                 <---------AHL25(3)
                 <---------AHL25(2)
                 --------->AHL25(2)
                 <---------AHL20(2)
                 --------->AHL12(3)
                 --------->AHL25(1)                          --------->ANAC55(1)
                 <---------AHL25(1)                          <---------ANAC55(2)
                 --------->AHL12(1)                          --------->ANAC46
                 <---------AHL12(1)                          --------->ANAC58
                --------->AHL12(2)                    --------->O2 ----------->HVH21     -----------
               <---------WOX13(2)           >>>>>>>>>SARD1   --------->ANAC58          <---------ALFIN1
               --------->WOX13(2)     <------ZmHOX2a(1) ----------->HVH21    ----------->HVH21
         ---------->DOF2             ----------->GT1  --------->ANAC46     --------->ALFIN1---------
      <---------HSFB2a(2)<----------DOF2    >>>>>>>>>CBP60g  --------->ANAC55(2)    ----------->HVH21
 
tcttatatactagaaagaaattaaatttcttttaaaaaacaggagaaatttgggtccaagtgacacgcaagtgatgggctgggacgagggacacctgtaa  4053900
                                  --------->AHL12(2)
                                  <---------AHL20(2)
                                  <---------AHL25(2)
                                  <---------AHL12(3)
                                  --------->AHL25(1)
                                 --------->AHL25(3)                                             ----
                                 <---------AHL12(1)                                             ----
                                 --------->AHL12(1)                                             <---
                                <---------CCA1(1)                                               <---
                                <---------RVE1(1)                                               ----
                               --------->ARR11(3)                                               ----
                               <---------GLK1(2)                                                <---
                         --------->AHL20(2)                                                   <-----
                         <---------AHL20(2)               --------->WOX13(2)                  <-----
     <-----------------AGL1    <---------ARR11(3)         --------->AHL12(2)                  ------
   <---------PCF2        --------->YAB1                   <---------WOX13(2)                  ------
--------->ALFIN1       --------->WOX13(2)               <---------AHL20(2)                    ------
>RAV1(2)               <---------WOX13(2)            ----------->GT1                 <----------DOF2
-->GT1                --------->YAB5        ---------->DOF2 <---------ICU4       <----------DOF2----
 
aatgtggggaccctattggcaaaaacaattaaaagatttttttttgttaaagaaataagttaattagttcaatatttgtaatttctttctttcacaaaat  4054000
<- Previous    Next ->

AGI:  At5g12840.1   
Description:  HAP2A (EMBRYO DEFECTIVE 2220); transcription factor. Identical to Nuclear transcription factor Y subunit A-1 (NFYA1) [Arabidopsis Thaliana] (GB:Q9LXV5;GB:O23630); similar to CCAAT-binding transcription factor (CBF-B/NF-YA) family protein [Arabidopsis thaliana] (TAIR:AT3G20910.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO21904.1); contains InterPro domain CCAAT-binding transcription factor, subunit B; (InterPro:IPR001289)
Range:  from: 4050843    to: 4053537    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version