AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                     ----------->GT1
                                                     --------->YAB1
                                                    <---------YAB1
                                                    <---------TOE2(3)
                                                    <---------TOE1(3)
                                              <---------------AGL15   <-------TEIL
                                           <-------TEIL            <------MYB46(1)
                                           ------>ZmHOX2a(2)       ----------->GT1
                       <---------ZAT18    <------ZmHOX2a(2)        <------MYB83
              --------->TOE2(3)          <---------GATA12--------->WOX13(2)                       --
              --------->TOE1(3)          --------->GATA12<---------WOX13(2)                       <-
     <----------DOF2   --------->ZAT18   <---------ARR14(2)   <---------YAB1                     <--
 <----------DOF2  ---------->DOF2        --------->ARR11(2)  <---------------------WRI1   <---------
--WRKY18(1) <---------ARR11(3)           <---------ARR11(2)  <---------TOE2(3)        --------->MYB59
-->HVH21   <------ZmHOX2a(1)             --------->ARR14(2) <-----------GT1   <----------DOF2<------
 
gaaactttctttgaggaccttaaaagtccacaacgtttttatgggatccatatttatggtaatttacgataggtacaatgactttgagttaggctttagg  3914100
    <--------P
  ----------->GT1
  <------MYB46(1)                                                                          ---------
  <------MYB83                                                                       --------->ANAC58
<---------WOX13(1)       --------->YAB1                                              <---------ANAC55(2)
------->ATHB12           ----------->GT1                                             --------->ANAC46
--------MYB46(3)      --------->YAB1                                                 --------->ANAC55(2)
-----TEIL       ----------->GT1                                                      --------->ANAC58
-DOF2          <---------TOE2(3)                                                     --------->ANAC55(1)
---TOE2(3)   ---------->DOF2             >>>>>>>ZML2                             --------->YAB1
 
ttgattggtagattaacaaaggtaagaatagtaaaccatttgttctagttatctgttttgaaaatgagatagaactaatttgtatcatacgcaatgtctc  3914200
                                                  ----------->HVH21
                                                <---------bZIP60(2)
                                        <---------HSFB2a(2)
                                        --------->HSFB2a(2)
                                    --------->ZAT14              --------->RVE1(2)
                                    <---------ZAT14  --------->bZIP60(1)
    <---------At5g28300   --------->ZAT14       <---------bZIP60(1)                   --------------
   <-----------GT1        <---------ZAT14       --------->bZIP60(1)   --------->AtMYB61  <----------ID1
<----------DOF2           ---------->DOF2  --------->YAB1       --------->YAB1     ----------->GT1
>RVE1(2)     <-----------GT1        --------->ZAT18  <---------bZIP60(1)    --------->TOE2(3)
 
aagcttttactgttttttacagaaaacagtaaaccggactgtactagaatgatgtgacataagtcaaaaatcaccaaaacataaatgagaaaaaaacaaa  3914300
                                                                       --------->PCF2
                           <-----------HVH21           <---------HSFB2a(2)
                          --------->ALFIN1        --------->KAN1     <-----------GT1
                         <-------MYC3    <---------MYB46(3)       <---------WOX13(2)
     <---------AHL12(2)  ------->MYC3<---------DEAR3(1)--------->HSFB2a(2)<---------ALFIN1
    --------->AHL12(1)   --------->TOE1(2)        <---------ALFIN1--------->WOX13(2)      --------->HSFC1(2)
    <---------AHL12(1)  --------->TGA1a  --------->MYB55(2)  ----------->GT1 ---------->DOF2
    --------->AHL25(2)  ==============================================bZIP_DOF            <---------HSFC1(2)
---------->ANAC81       <---------TGA1a --------->ALFIN1   ---------->DOF2----------->RAV1(1)<------
 
caaacaaaaatttagtagagttttcaaacgtgtgagtggcacggtgggagggaacactctagaaaagaaaattagccccacaaagtcactagaagcatct  3914400
                                                                                      <---------ARR11(2)
                                                                                      <---------ARR14(2)
                                                                                      --------->ARR11(2)
                                                                                     <-------GAMYB
                                                                                    <---------DEAR3(2)
                                                                                   <---------ANAC46
                                                                                   <---------RAP2.6(2)
                                                                                   <---------DEAR3(1)
                                                                                 ------------>MYB.PH3(1)
                                      <---------At4g35610                        ------------>AtMYB77
                                      --------->At4g35610             <---------ZAT2<---------MYB46(3)
                                      <---------ZAT2                  --------->ZAT2----------->GT1-
 --------->ANAC58                   <---------ZAT18      <---------GLK1(2)--------->REM1(1)       --
 --------->ANAC46                   --------->ZAT18   --------->ANAC46--------->At4g35610         <-
 --------->ANAC58            <---------ZAT6 <---------DOF5.7(1)       <---------At4g35610         --
---CCA1(2)      <-----------GT1<---------KAN1      <---------REM1(2)*TSS <-------TEIL--------->At5g28300
 
cttcaaggcattctctggtttaccctattttagagtgagtgagctcgtcttctctccacagaaacttaacttgagctgcatcaatggcggttacattttc  3914500
                                                         --------->GATA12
                                                         <---------GATA12
                                                        --------->REM1(1)              --------->ATHB51
                                                   --------------->AtSPL8              <---------ICU4
                                                   --------------->AtSPL3    --------->KAN4(2)
       --------->ANAC46                       --------->At5g28300            --------->ARR14(2)
     <---------ALFIN1                        --------->LBD16                 <---------ARR14(2)
     --------->ANAC46                        ----------->GT1  <---------ANAC46      --------->YAB1
    <---------REM1(2)                       --------->ATERF1(2)         --------->ANAC46
   <---------ALFIN1                         <---------ATERF1(2)--------->LBD16   <----------DOF2
------>ZmHOX2a(2)                    --------->ARR11(3)<-------TEIL     --------->ANAC58           -
-------->GLK1(1)                     <---------ARR11(3)------->TEIL     --------->ANAC58--------->WOX13(2)
------->GATA12                   <------ZmHOX2a(1) <---------------AtSPL3   <---------KAN1        <-
--------GATA12            --------->TOE1(2)<---------LBD16   <---------LBD16--------->KAN1       <<<
------->ARR11(3)<---------ARR11(3)  <---------KAN1 <---------------AtSPL8   <----------TaMYB80   <--
 
tgatctccacacagagcgaggtctcaaaaccctcgaggaacatctcgccggtaaaacgtacatctccgggtaaacacgcatattctttcataatttgcta  3914600
                                                                                                  --
                 --------->ARR11(3)                                            <---------MYB46(3) <-
   --------->YAB1<---------GLK1(2)                                           <-------GAMYB       ---
--------->WOX13(1)                                                    <---------At4g35610     ------
-------->YAB5    --------->GATA12                    <---------MYB52(1) <----------DOF2   <---------TOE1(3)
--------YAB1     <---------RVE1(2)             <---------GLK1(1)      --------->At4g35610 <---------TOE2(3)
<<<<<<<GT-1      <---------GATA12      --------->ARR11(3)          <------ZmHOX2a(2)   ----------->HVH21
-------ARR11(3)----------->ARR10      --------->REM1(1)        <---------At4g35610   <---------ANAC46
 
tatcattcatcaatagcttagattttgcacagtttctacttacatcttggaactcggttttgtttcagcgatcagctttcggttgatgatgtgaaggttt  3914700
              --------->RVE1(2)
              --------->ARR11(2)                      --------->GLK1(2)
              <---------ARR11(2)                     <---------GLK1(2)
    <---------RAP2.6(3)                             --------->YAB5
   <---------ANAC58                               --------->SPL7(1)
   <---------ANAC46  --------->ALFIN1           <---------SPL7(1)
   <---------ANAC58  ----------->HVH21        --------->ALFIN1<---------ANAC58     <-------TEIL
  ----------------->AGL1<---------AtMYB61     <---------------AtSPL8            <---------HSFB2a(1)
 ------>NtERF2<---------ARR14(2)              <---------------AtSPL3    ------>MYB46(1)  --------->KAN1
------->At4g35610  <---------At4g35610   --------->STY1(2)    <---------ANAC58 --------->DAG2  -----
--------At4g35610<-----------RAV1(2)     <---------STY1(2) <---------MYB52(1)  <---------------AtSPL8
------>ANAC46 --------->GLK1(2)         --------->ANAC58  <-------GAMYB ------>MYB83--------->MYB52(2)
--->ARR11(2)  --------->ARR14(2)        --------->ANAC58 <-----------RAV1(1) ---------->DOF2  <-----
 
acgctgccgtattggagaatccaggtgatggttttcccaatgctagcaagtggtacgattctgttgcttctcacctagctaaaaggttcgttttattctc  3914800
                            --------->ATHB12
                          <---------WOX13(1)                                          --------->MYB52(1)
                   ------>ZmHOX2a(2)           --------->YAB1                      --------->At4g35610
                 <---------ARR11(3)            --------->YAB5                   ---------->DOF2
                 <---------RVE1(2)             <---------ICU4               --------->LBD16
                 --------->ARR11(3)           --------->ICU4               <---------LBD16
       <---------ANAC58 --------->ATHB12      <---------KAN1   --------->YAB5--------->LBD16
       <---------ANAC58<---------YAB1<----------DOF2          <---------KAN1<---------LBD16
---->KAN1        <---------GATA12   <---------DOF5.7(1) <----------DOF2   <---------LBD16          <
----YAB1         --------->GATA12  <----------DOF2      --------------------->WRI1 <---------At4g35610
 
attcgtttttgcttcttgttgatcttctgattgaatggctctttggagaatgatgacttctttgaatgtttcagttttcccgggaaagcagacggagtga  3914900
         <-----------RAV1(1)
         --------->ALFIN1
         <---------REM1(1)
      --------->ALFIN1
      <---------AtMYB61
    <---------MYB46(3)
   --------->ALFIN1                                                         ------>NtERF2
   <---------AtMYB61                                                        >>>>>>>>>>>>>>>>>LFY
 <------MYB83                                                              --------->bZIP60(1)
 <------MYB46(1)                                                           --------->ANAC58
--------->MYB111(1)                                                        --------->ANAC58
--------->MYB55(2)          <---------At4g35610          ----------->GT1   --------->ANAC46
<---------AtMYB61     <---------At4g35610            --------->DAG2        <---------bZIP60(1)
--------->ALFIN1      --------->At4g35610           ---------->DOF2      --------->YAB5
<---------MYB46(3)------>ZmHOX2a(1)               <---------------AGL15 ----------->TGA1
--------->MYB111(2)   ----------->RAV1(2)         --------------->AGL15 <---------KAN1
--------P=========================RAV       <---------TOE2(3)           ----------->HVH21
 
gagttggtggtggtgttgctcctccatctgaagctcatccacatactgaggtactaaaagtagtcaaaatatggaatgacgccaatgtaatctgtttgta  3915000
<- Previous    Next ->

AGI:  At5g12100.1   
Description:  pentatricopeptide (PPR) repeat-containing protein. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT5G65560.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO15979.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 3911364    to: 3914081    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At5g12110.1   
Description:  elongation factor 1B alpha-subunit 1 (eEF1Balpha1). Identical to Elongation factor 1-beta 1 [Arabidopsis Thaliana] (GB:Q84WM9;GB:Q9SCX2;GB:Q9SCX4); similar to elongation factor 1B alpha-subunit 2 (eEF1Balpha2) [Arabidopsis thaliana] (TAIR:AT5G19510.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO67292.1); contains InterPro domain Translation elongation factor EF1B, beta/delta chains, conserved site; (InterPro:IPR001326); contains InterPro domain Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange; (InterPro:IPR014038); contains InterPro domain Glutathione S-transferase, C-terminal-like (Inter
Range:  from: 3914469    to: 3915969    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version