AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                         <------ZmHOX2a(1)  --------->AHL12(2)
                 <---------AHL20(3)    --------->YAB5
                 --------->AHL20(3)   --------->ICU4
                 <---------AHL12(3)   ----------->GT1
                 --------->AHL20(2)   <---------YAB5
                 <---------AHL20(2)   <---------YAB1
            --------->AHL12(2) --------->AHL25(2)                                            -------
            <---------YAB1     --------->AHL20(3)                                       --------->ANAC58
            <---------YAB5    <---------AHL25(3)<---------WOX13(2)                      --------->ANAC58
         <---------YAB5 ----------->GT1-------->HAHB4                            --------->ANAC55(2)
       ----------->GT1 <---------TOE2(3) <---------YAB1                          <---------ANAC55(2)
----->AHL20(2)   <---------AHL25(1) --------->YAB1            --------->ARR11(3) <---------ANAC58
------AHL20(3)   --------->AHL25(1) <---------ICU4            <---------ARR11(3) <---------ANAC46 --
------AHL20(2)   --------->AHL12(3)--------->ICU4            <---------CCA1(2)   <---------bZIP60(2)
----->AHL20(3) <---------AHL12(2)--------->AHL12(2)         ------->TEIL         <---------ANAC58 <-
-->AHL20(2) --------->ICU4    --------->YAB1<---------AHL12(2)--------->RVE1(2)  <---------ANAC55(1)
aaaatacaattagttattatttatataaggaaataaaaataatgataaataaatttagacatgtatatctatgtaatagaaattacgtggtaagacatat  3370100
                                                                         <---------AHL20(3) --------
                                                                         --------->AHL25(2) <-------
                                                             <---------AHL20(2)            ---------
                                                             <---------AHL20(3)     <----------ID1
                                                            <---------AHL20(2)      ================
                                                            --------->AHL20(2)      <------ZmHOX2a(1)
      ---------->DOF2                                       --------->AHL25(3)      ================
-->KAN1                                              <---------AHL20(2)  <---------AHL20(2)<--------
------->TOE2(3)            ---------->DOF2 --------->HSFB2a(2)           --------->AHL20(3)<--------
---------DOF2     --------->At4g35610      <---------HSFB2a(2)         <---------YAB1      ---------
actttaatacaaagatagactagctcaaacaaaagtctacggttttccaaaacgatttacttataaatttgggtattattttgtttaggaacaaataaat  3370200
       <-----------------------TaNAC69(2)                                              <---------WOX13(2)
       ------>ZmHOX2a(2)                                                               <---------AHL12(2)
       <-------TEIL                                                                   <---------AHL12(2)
      <------ZmHOX2a(2)                                                              --------->AHL25(1)
     --------->ARR14(2)                                                              <---------AHL12(3)
     <---------ARR14(2)                                                              <---------AHL20(3)
     --------->ARR11(2)                                                              --------->AHL20(1)
     --------->RVE1(2)                                                               <---------AHL20(1)
     <---------ARR11(2)                                                              --------->AHL20(2)
     --------->GATA12                                                                --------->AHL20(3)
     <---------GATA12                                                                <---------AHL20(2)
    <------ZmHOX2a(1)                                                                <---------AHL25(1)
----->AHL12(1)                                                                       --------->AHL12(1)
------AHL25(3)                    --------->TOE1(2)                                  --------->AHL25(2)
------AHL20(2)                   --------->ANAC58                                    <---------AHL12(1)
---->AHL25(3)                  <---------ALFIN1                                      <---------AHL25(3)
-----AHL25(1)                <---------ALFIN1                                        <---------AHL25(2)
---->AHL25(1)                --------->AtMYB61                                       --------->AHL25(3)
-----AHL20(2)               --------->ANAC46                                        <---------AHL25(1)
---->AHL20(2)             --------->DEAR3(1)                                        --------->AHL25(1)
---->AHL12(3)             <---------ALFIN1                                          --------->AHL12(3)
--->AHL12(2)           --------->AtMYB61                                            <---------AHL12(3)
----AHL12(2)           <---------ALFIN1                                             --------->AHL12(1)
---AHL12(2)            --------->DEAR3(1)                                           <---------AHL12(1)
->AHL20(2)            --------->MYB46(3)                                            --------->AHL20(2)
--AHL25(3)          --------->AtMYB61                                               <---------AHL20(2)
>AHL20(2)           <---------ALFIN1--------->MYB52(1)                              --------->AHL25(3)
>AHL25(1)           --------->DEAR3(1)  --------->KAN1--------->At4g35610          <---------AHL12(2)
==============HOX2a_HOX2a --------->AtMYB61     --------->GATA12                   --------->AHL12(2)
=============HOX2a_HOX2a --------->MYB46(3)     <---------GATA12                  --------->YAB1
-AHL20(2)          --------->MYB46(3)   --------->CCA1(2)                     --------->HSFB2a(2)
-AHL25(1)        <---------ALFIN1--------->ANAC58     <---------At4g35610     <---------HSFB2a(2)---
>AHL25(3)        --------->ANAC46--------->ANAC46--------->CCA1(2)        --------->GLK1(1)      ---
aaatcgaggatccatggtctccaccaccaccaccacacctaagagatgcgagatttaagctccatttacaaaaactgagttccaaaaataaattagcaaa  3370300
                                      <---------RVE1(2)                          --------->AHL25(2)
                                  <---------ANAC58                               --------->AHL12(3)
               --------->ARR11(3) <---------ANAC58         <---------MYB46(3)   --------->AHL20(3)
          ------->GAMYB <---------At4g35610  --------->ANAC58                   --------->AHL25(2)
          --------->TOE2(3)  <---------ANAC58--------->ANAC55(1)                --------->AHL12(2)
         --------->MYB46(3)  <---------ANAC58--------->ANAC46            <---------GATA12
 --------->WOX13(2)     --------->At4g35610  --------->ANAC58      --------->RVE1(2)<-----------GT1
------>TOE2(3) <---------ARR11(3) <---------ANAC46<---------DOF5.7(1)    --------->RVE1(2)
------>TOE1(3)<---------CCA1(2)  --------->MYB52(2)       <---------TOE1(2)     <---------AHL25(2)<-
ccctaattttcaaccacaaatctttggagcttacgttccttgatatacacgcctcttctccttggttcaatagcaaaatccaaaattattccatctagtt  3370400
                                            <---------TOE1(3)         ------>ZmHOX2a(1)
                                        <----------DOF2           --------->ARR11(3)
           --------->KAN1             --------------->AGL15       <---------ARR11(3)
          <---------ARR11(3)          <---------------AGL15      --------->KAN1             <-------
    ------>ZmHOX2a(2)        <---------GLK1(2)                   --------->GLK1(1)         <--------
  --------->GATA12          --------->KAN1  <---------TOE2(3)    <---------GLK1(1)         <--------
  <---------GATA12  <<<<<<<<<TBF1  <-----------GT1              <---------RVE1(2) ------------>CBF<-
---------DOF2    <<<<<<<<<TBF1  --------->TOE2(3)       <---------DOF5.7(1)    <------------CBF<----
cctttgatctcaaggtattcttcttcttctcatattcttaactctttaaggctggctactcttatttgatatccttctgaaatattgcaatttccttttt  3370500
      <---------ANAC58                          --------->YAB1
<------------CBF   <---------ANAC46       --------->TOE2(3)--------->O2
--------->WOX13(2) <---------ANAC58 <---------AHL20(2)     <---------ANAC46      --------->DOF5.7(1)
<---------WOX13(2)*TSS           --------->MYB52(2)        <---------O2         --------->MYB52(1) -
--DOF5.7(1)  --------->MYB46(2)<---------MYB52(1)        ------->GAMYB       --------->ANAC46      -
-DOF5.7(1)   --------->MYB59 <---------MYB46(3) -------->HAHB4               --------->ANAC58      -
--DOF2<---------ANAC58  <-----------RAV1(2)     <---------ICU4               --------->ANAC58    ---
--------YAB1<---------MYB55(1)<-------GAMYB    --------->ICU4           ------->GAMYB            <--
-------GT1 <---------MYB52(1)----------->GT1   <---------ATHB51--------->HSFB2a(2)      ----------->RAV1(1)
tctaattgtgcgttgttaggtagcgtctcaggtcgttatttgatttcttaataatggcaacgacgtctagtacaacgaaaacgaaacgggacaacaaaaa  3370600
      <------ZmHOX2a(2)                                                <---------AGP1
     --------->RVE1(2)                                                 <---------RVE1(2)
     --------->AGP1                                                    <---------GATA12
     <---------ARR11(3)                                                ------->TEIL
     <---------GATA12    --------->ANAC58                         --------->At4g35610
     --------->GATA12    --------->ANAC58                         <---------At4g35610
-------->P             ---------->DOF2             ----------->RAV1(2) --------->GATA12
----->MYB46(1)     <------NtERF2             <---------YAB1   --------->ANAC58
----->MYB83--------->RVE1(2)               <---------ICU4     --------->ANAC58
-------->MYB52(1)  --------->At4g35610     --------->YAB1    --------->SPL7(1)------>ZmHOX2a(2)   <-
------>AtMYB61   --------->ANAC46         <---------YAB5  <---------MYB52(2)--------->GATA12  ------
-------MYB59 --------->YAB5  ---------->DOF2 --------->At4g35610<-----------RAV1(2)           ------
cctaaccagatcaaaatcactcggcagaaagccaaagccggtctcatcatcagagcctgaagcgaacgcagatggatctgatcggaaaacaattgggaag  3370700
                                       --------->ARR11(2)               <------NtERF2
                                       <---------ARR11(2)              <-----------HVH21
                           --------->ZAT2   <-----------HVH21          ------>NtERF2
       <---------YAB5      <---------ZAT2  --------->LBD16            --------->DEAR3(1)
      --------->WOX13(2)   --------->At4g35610    --------->ARR11(3)  <---------ANAC46  --------->HSFC1(2)
      <---------WOX13(2)   <---------At4g35610    <---------ARR11(3)------->GAMYB       <---------HSFB2a(1)
   <---------MYB59  ------>MYB83       --------->ARR14(2)          --------->ANAC46     --------->HSFB2a(1)
---------DOF2       ------>MYB46(1)    <---------ARR14(2)          --------->DEAR3(1)   <---------HSFC1(2)
--->ANAC58        --------->TOE1(2)  ----------->HVH21          <---------KAN1     --------->YAB1
--->ANAC58--------->At4g35610        <---------SPL7(1)    ---------->DOF2        --------->RVE1(2)
cctttgcctaattatctgaaacctacaatcagctcgagaccggacccggtcaagttcttgagaaagaacaacgccgtcgaagaaaatcagaagcttcttc  3370800
                   <---------DOF5.7(1)                        ------>ZmHOX2a(2)           <---------ZAT2
                  ------>ZmHOX2a(1)                          <<<<<<<<<GATA-2              --------->ZAT2
            <---------YAB5                                   <<<<<<<<<GATA-3            <---------ALFIN1
           <---------RVE1(2)                                 <<<<<<<<<GATA-4          <---------ALFIN1
          --------->YAB1                                     <---------GLK1(1)       --------->MYB46(3)
       ------>ZmHOX2a(1)                                     ========================HOX2a_HOX2a
    ========================HOX2a_HOX2a                      <------ZmHOX2a(2)       <---------MYB55(2)
    <------ZmHOX2a(2)                                        <<<<<<<<<GATA-1        --------->ANAC58
    =====================HOX2a_HOX2a                        --------->ARR11(3)      --------->ANAC58
   --------->ARR11(3)                                       <---------ARR11(3)    <---------ALFIN1
   --------->ARR11(2)                                       <---------GATA12     --------->MYB46(3)
   <---------ARR14(2)                                       <---------AGP1    ------>ZmHOX2a(1)
   --------->ARR14(2)                                       --------->GATA12----------->RAV1(2)
   <---------ARR11(2)      <----------DOF2       <---------At4g35610        --------->At4g35610
   <---------ARR11(3)------>ZmHOX2a(1)           --------->At4g35610        <---------At4g35610
gtagacgatcctttgatcatcctccttcgtctttgacttctccatcaacttcatcagcccatagatctctcaatacctctcctgcccacccacacctgcg  3370900
          --------->ARR14(2)                                    <---------ZAT2
          <---------ARR14(2)                                    --------->ZAT2 --------->At4g35610
       <---------DEAR3(1)                                       --------->At4g35610          -------
      <---------LBD16                                        --------->At4g35610            --------
      --------->LBD16                             <----------DOF2            <-----------RAV1(2)
     --------->ANAC46                            <---------DOF5.7(1)    <------MYB46(1)   <---------ZAT14
    <---------LBD16                            <---------ARR11(3)<-----------RAV1(2)      --------->ZAT14
 --------->KAN1                        <---------ANAC58      <---------At4g35610  <------ZmHOX2a(1)
>TOE2(2)  --------->ARR11(2)           <---------ANAC58 --------->AtLEC2<------MYB83      --------->SPL7(1)
>TOE1(2)<---------MYB46(3) <-----------HVH21  --------->REM1(1) <---------At4g35610   <-------------
->RAV1(2) <---------ARR11(2)        <---------DEAR3(1)<---------AtLEC2 <---------AtMYB61<---------SPL7(1)
agacaaacccgcggttccaagggagaagcctgtcactggtctgcgttctacatctttccatggaagcagcaggggaggtctcagaggaagcagtacggtg  3371000
<- Previous    Next ->

AGI:  At5g10660.1   
Description:  calmodulin-binding protein-related. similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G24880.1)
Range:  from: 3370519    to: 3371935    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version