AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                              <---------ARR14(2)                      <-----------TCP11(1)
                                              <---------ARR11(2)                <---------PCF2------
                                              --------->RVE1(2)                ----------->TCP11(1)
                                              --------->GLK1(2)              --------->ALFIN1xxxxxxx
                                         <---------ZAT14                   <-----------RAV1(1)------
                                   <------ZmHOX2a(2)                     <---------KAN1   <xxxxxxxxx
                                  --------->GATA12 xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)  xxxxxxxxxxx
                                  xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)   xxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                  <---------ARR11(3)                    <---------RVE1(2)xxxxxxxxxxx
                               xxxxxxxxxxxxxxxx>smallRNA(si3)          xxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                               xxxxxxxxxxxxxxxx>smallRNA(fl3)         <xxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
                               xxxxxxxxxxxxxxxx>smallRNA(se3)      <---------ARR11(3) <xxxxxxxxxxxxx
                        xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)       xxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                       <----------DOF2   --------->ZAT14           xxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                    ------>NtERF2 --------->RVE1(2)xxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3) xxxxxxxxxxxx
       --------->YAB1  <---------DOF5.7(1)    --------->ARR14(2)   --------->ARR11(3)<xxxxxxxxxxxxxx
       --------->YAB5xxxxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)       --------->RVE1(2)--------->At4g35610
     <-----------ARR10<---------DOF5.7(1)--------->ZAT18          --------->RVE1(1) <---------At4g35610
 <---------At4g35610---------->ID1--------->ARR11(3)          <xxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)
----ZAT18    <----------DOF2  xxxxxxxxxxxxxxxxx>smallRNA(si3) <xxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)<---
->bZIP60(2)xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)--------->ARR11(2) xxxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
actcagcaaatcatacctttctcggccttttggctaagatcaagtgtagtatctgttcttatcagtttaatatctgatatgtgggccatcggcccacacg  2975100
xxxxxxxxxxxxsmallRNA(si3)                                                                         --
xxxxxxxxxxx>smallRNA(fl3)                                                                        <--
--->ANAC46                                                                                  xxxxxxxx
xxxxxxxxxxxx>smallRNA(se3)                                                           xxxxxxxxxxxxxxx
--->ANAC58                                                                           xxxxxxxxxxxxxxx
xxxxxxxxxxxsmallRNA(si3)                                                           <---------ANAC46
xxxxxxxxxxx>smallRNA(fl3)                                                          <---------ANAC58
xxxxxxxxxxxxxxx>smallRNA(se3)                                                      <---------ANAC58
xxxxxxxxxxxsmallRNA(l2)                  xxxxxxxxxxxxxxxx>smallRNA(i)     <---------ZAT18  xxxxxxxxx
xxxxxxxxxxx>smallRNA(fl3)   <---------DOF5.7(1)     <----------DOF2   <---------ANAC58   <---------ANAC58
xxxxxxsmallRNA(le3)  <------ZmHOX2a(1)<---------ANAC58                <---------ANAC58   <---------ANAC58
------ARR11(3) <---------TOE2(3)      <---------ANAC58       <---------KAN1      xxxxxxxxxxxxxxxxxxx
atattaactctattttttaagggaggaagcccgtttagatagcttgctatctgggctttcacgagtctcccatgcgttgcactattgcgagggcttggct  2975200
       --------->AHL20(2)                                      --------->AHL20(2)
  --------->LBD16                                              --------->AHL20(3)
  ------>NtERF2                                                <---------AHL20(2)
 --------->ANAC58                                              <---------AHL20(3)
 --------->ANAC58                                              --------->AHL25(1)
 --------->ANAC46                                      --------->ANAC58
------->GAMYB                             --------->YAB5       <---------AHL25(2)
--------->MYB46(3)              --------->DAG2         --------->ANAC58
------>P<---------AHL20(2)     ---------->DOF2<---------AHL20(2)  --------->RVE1(2)
-------ALFIN1      <---------TOE2(3)      ----------->GT1      --------->AHL25(2)     <---------ANAC46
xxxxxxx>smallRNA(fl3)          --------->DOF5.7(1)    --------->DAG2                  <---------ANAC58
xxxxx>smallRNA(si3)<---------TOE1(3) ---------->DOF2  --------->DOF5.7(1)     <-------TEIL
xxxxxxx>smallRNA(le3)     --------->AHL20(2) <---------AHL25(1)<---------AHL25(1)  <----------DOF2 -
xxxxxxx>smallRNA(fl3)     <---------AHL25(3) --------->AHL20(2)<---------AHL25(3) <---------DOF5.7(1)
xxxxxxx>smallRNA(si3)<------ZmHOX2a(1)--------->DAG2 ---------->DOF2      ------->TEIL<---------ANAC58
caacccgccatttattcagtctaaggaaataaaaaaaagctaaagtgattaaatcgaaaagccaaataaaatccatgaacgtccgtctttcttgtatagc  2975300
           <----------DOF2                            <---------------AtSPL3
     <---------MYB52(1)                           <---------ARR11(3)                         -------
    >>>>>>>>>TAC1                                 --------->AHL20(1)             <---------ALFIN1---
    <---------ZAT2         --------->YAB1       ------->TEIL     --------->AHL25(3)          ------>ZmHOX2a(1)
    <-------GAMYB        --------->RVE1(2)   ----------->GT1--------->TOE2(3)    --------->AtMYB61
------------>AtMYB77    --------->YAB1    --------->DOF5.7(1)    --------->AHL12(1)        ---------
---------->HVH21<------ZmHOX2a(1)       ---------->DOF2     <---------MYB59     --------->MYB46(3)
ccatgacagttgggcttaaggagcccataatcaaaacccatacaaaagatgtatatattagtacctaaataaattgcaattcgaccactctgtttcctga  2975400
                                                                    --------->O2 --------->ANAC58
               <---------ARR11(2)                                   <---------PIF3(3)
               <---------GLK1(2)                                    <---------O2 --------->ANAC58
     ------>ZmHOX2a(1)                                              --------->TGA1a
    --------->TOE2(3)    --------->WOX13(2)        <---------YAB1   <---------TGA1a   ------>ZmHOX2a(1)
 <-----------GT1--------->KAN1     --------->TOE1(3)            <----------------PIF3(2)
--------->KAN1 --------->ARR11(2)  --------->TOE2(3)--------->YAB5<---------ALFIN1   <---------ANAC58
-->LBD16       --------->ARR14(2) ----------->RAV1(2)<---------GLK1(2)  ------------>CBF           <
------>GATA12  <---------ARR14(2)=============================================MYC_MYB<---------ANAC58
-->RAV1(2)   --------->ANAC46    -------->P      --------->MYB52(1) >>>>>>>>>>HY5<---------ANAC55(2)
gatttatcctcagtacccgatactctaaaattgacttacctgaaattcaacataacgattctcaaacttccacgtggcaatatcacgtccttgcacttgg  2975500
                               ---------->DOF2                            --------->HSFB2a(2) ------
                          <---------DEAR3(2)      <------NtERF2    <-----------GT1      <---------ALFIN1
                      <---------bZIP60(1)       <---------DEAR3(1) --------->YAB1    --------->ANAC46
                      --------->O2              *TSS      --------->HSFB2a(2)<---------GLK1(2)<-----
                      --------->bZIP60(1)     <-----------HVH21 <---------ICU4--------->ARR14(2)
       <-----------GT1<---------O2         <---------At5g28300  --------->YAB1--------->GLK1(2)
---------REM1(2)   --------->ANAC46       <-----------GT1<---------ETT(2) <---------HSFB2a(2) ------
tcttcacgattttcgtttttaaacgacgtcgtttcaaagagcattataccgtcgtcgatgtcgagaattatcaccatctagaatcttccctcaacctcta  2975600
           <---------ARR11(2)                                                                   <---
          <---------CCA1(2)                                                              ------>ZmHOX2a(2)
        <---------ANAC58                                                               --------->GATA12
        <---------ANAC46                        --------->RAP2.6(2)                    <---------RVE1(2)
        <---------ANAC58--------->TOE1(3)       --------->ANAC58                <----------DOF2 ----
     <----------DOF2    --------->TOE2(3)       --------->ANAC58               --------->TOE2(3)----
--->HSFC1(1)   ------>ZmHOX2a(1)                --------->ANAC46            <-----------GT1<--------
----HSFB2a(2) --------->TOE1(3)              --------->DEAR3(1)      <-----------GT1   <---------GATA12
--->HSFB2a(2) --------->TOE2(3)      <----------DOF2           <---------YAB5<-----------GT1   -----
gaaaacaactttcgtatccttcaaaaaccctaaaccctagcttttgcacagacgcaatttcatcgcatcattttgcaattttcctttactgatctgtcac  2975700
                                                        --------->REM1(2)                  <--------
                                                       <---------MYB52(1)                  <--------
                                                       ----------->HVH21        <---------At4g35610
                                                      --------->LBD16           <---------ZAT2
                                                      <-----------HVH21         --------->ZAT2
                                       --------->At4g35610      --------->ARR14(2)         ---------
                              <-----------ARR10     <------NtERF2               --------->At4g35610<
                             <---------At4g35610   ------>NtERF2<---------ARR14(2)     <---------At4g35610
------ALFIN1                 --------->ZAT2       <---------DEAR3(1)     <----------DOF2   <--------
----->AtMYB61                <---------ZAT2       --------->DEAR3(1)    <---------DOF5.7(1)<--------
----->DEAR3(1)               --------->At4g35610  --------->ANAC46  ------>ZmHOX2a(1)  --------->KAN1
---HVH21                  --------->LBD16  --------->KAN1       --------->ARR11(2)     --------->At4g35610
---->MYB46(3)          -------->P   ------>ZmHOX2a(1)<---------ANAC46  <---------DOF5.7(1)<-------TEIL
cacctcttgaatttcgaaaccatggctaccgcagctctcctccgctctattcgacgccgtgaagtcgtttcctctcctttctcagcttacagatgcgtaa  2975800
                 ------>ZmHOX2a(2)                                                ------>ZmHOX2a(2)
    --------->ARR11(3)                                                          --------->GATA12
    <---------ARR11(3)      <----------DOF2                                     <---------ARR11(3)
   <---------CCA1(2)    <---------CCA1(2)                                       --------->RVE1(2)
-ANAC58        --------->ARR11(3)                                           --------->ANAC55(2)
-ANAC58        <---------ARR14(2)         <---------MYB52(1)        <---------MYB59  <---------RVE1(2)
>ANAC55(2)     <---------GATA12          <-----------HVH21         --------->At4g35610       <------
----------DOF2 --------->ARR14(2)--------->ANAC55(2)             --------->ZAT18<---------GATA12
-ANAC55(2)     <---------ARR11(3)--------->ANAC46                <---------ZAT18--------->ARR11(3)
-ANAC46        --------->GATA12<-----------GT1      --------->YAB1 <---------At4g35610   <----------
gtctttatatcttctctcgatcttcttctatcttttacgagacctgttagcgaaatcagagtttcaagtgagctaacttacatgatctgattttactctt  2975900
                                                        <---------ARR14(2)                     -----
                                                        --------->ARR11(2)                   -------
                                                    <---------ANAC58                --------->ANAC58
                                                    <---------ANAC58                --------->ANAC46
                                               <---------ANAC58                     --------->ANAC58
              --------->ANAC58             --------->GLK1(1)                      ---------->DOF2
  <---------YAB1                   <---------MYB46(3) ----------->HVH21        <----------DOF2 -----
-----DOF2     --------->ANAC58     --------->KAN1   ----------------->AGL1   --------->At4g35610   <
---DOF5.7(1)  --------->ANAC46 <---------YAB1  <---------ANAC58       <-----------RAV1(1)--------->ALFIN1
-GT1  <-------TEIL   <---------HSFB2a(2)   <---------KAN1 ------>ZmHOX2a(2)  <---------At4g35610   <
ttcttatggttcatttctcgcaatctcgaaaatgatgtttgttcgaatttccttggcctgatctggttcaatcttgttgcagctttcaagcagtgggaaa  2976000
<- Previous    Next ->

AGI:  At5g09585.1   
Description:  U2.5; snRNA. gi|17664|emb|X06476.1|ATU25 Arabidopsis thaliana U2 RNA gene (U2.5)
Range:  from: 2974556    to: 2975307    Orientation: Forward
Links:  TAIR  MIPS  AIP 
AGI:  At5g09590.1   
Description:  mtHSC70-2 (HEAT SHOCK PROTEIN 70); ATP binding / unfolded protein binding. similar to MTHSC70-1 (mitochondrial heat shock protein 70-1), ATP binding / unfolded protein binding [Arabidopsis thaliana] (TAIR:AT4G37910.1); similar to CPHSC70-1 (chloroplast heat shock protein 70-1), ATP binding / unfolded protein binding [Arabidopsis thaliana] (TAIR:AT4G24280.1); similar to cpHSC70-2 (HEAT SHOCK PROTEIN 70-7), ATP binding / unfolded protein binding [Arabidopsis thaliana] (TAIR:AT5G49910.1); similar to Heat shock 70 kDa protein, mitochondrial precursor (GB:P37900); similar to Heat shock 70 kDa protein, mitochondrial precursor (GB:Q01899); similar t
Range:  from: 2975549    to: 2978751    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version