AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                             <-------TEIL
                                                                            --------->ARR14(1)
                                                                           --------->GATA12
                                     --------->ZAT6                        <---------GATA12
                                     --------->AtMYB61                     --------->ARR11(2)
                              <---------ZAT14                              --------->ARR11(1)
                         <---------KAN1                                    <---------GLK1(2)
                         <---------YAB5                                    --------->ARR14(2)
                        --------->GLK1(2)--------->YAB1                    <---------ARR14(2)
                --------->WOX13(1)--------->AtMYB61                        <---------RVE1(2)     ---
          --------->At4g35610 --------->ZAT14                <---------SPL7(1)     <----------DOF2
          <---------At4g35610 <---------ZAT18  --------->TOE2(3)  ---------->DOF2 <---------DOF5.7(1)
      <-----------HVH21--------->YAB1<---------ALFIN1--------->YAB5        <---------ARR11(2)  <----
<----------DOF2<---------ETT(2)  --------->MYB46(3)  <-----------GT1      --------->KAN1      <-----
---------DOF5.7(1)<------ZmHOX2a(2) --------->MYB46(3)     <---------YAB5----------->ARR10    ------
 
catcttttgtgtcatctgtcgatcaagaatcagtgaaccaccactagtaatctaaatcactagtcgtacaaaagtttagattcgctctttacgttgttcg  2970300
           --------->ARR11(3)
     --------->YAB5
     --------->YAB1
     <---------ICU4
    --------->ICU4                                                                                 <
    <---------ATHB12                                                                           -----
------>WRKY38(1)                     <-----------GT1                                        --------
---GAMYB   <---------ARR11(3)   --------->WRKY38(1)              ----------->GT1       <----------DOF2
----MYB46(3)                  <-------GAMYB                   <-----------RAV1(1)    <---------HSFC1(2)
--->MYB52(2)           <---------ZAT14-------->P         <----------DOF2             --------->HSFC1(2)
 
ttgtccaatgatgagatgtttcagacttcagagcgttgatcaaccatacaggtctataagcttttgtgttgtttaatcccttggaagaagctttcacaaa  2970400
          <---------TOE2(3)
     --------->AtLEC2
  --------->TGA2(2)
 <-----------HVH21                                                                ------>MYB83
 <-----------TGA1                                                                 ------>MYB46(1)
--------->O2                                                                    --------->TOE2(3)
<<<<<<<<<<HY5                                                                   <---------MYB59
<---------bZIP60(1)                                                             <-----------------AGL3
--------->bZIP60(1)                                                    --------->DOF5.7(1)
<---------O2                                    <----------DOF2        ---------->DOF2
--------->bZIP60(2)                         <---------GLK1(2)      <---------AHL20(2)
--------->ANAC46                   ---------->DOF2                 <---------AHL25(3)
--------->TGA2(1)                 <---------WRKY38(1)              --------->AHL20(2)             --
<---------TGA2(1)                 <---------WRKY12               <---------WOX13(2)--------->WOX13(2)
-----------STF1                   <---------WRKY45               --------->WOX13(2)<---------WOX13(2)
---->MYB52(1)     --------->AHL12(1)       --------->KAN1<---------LBD16--------->DOF5.7(1)       --
->ANAC46  --------->DOF5.7(1)   <-----------HVH21<---------DOF5.7(1)   =============================
 
acgacgtcatacaaaggttgaatttttgatgggccagtcaaagcccatattcttttttttttcggagaaattaaaaaaggaaacctaattttgggtttgg  2970500
            <---------ANAC58
            <---------ANAC46
            <---------ANAC58
            <---------bZIP60(2)
          --------->MYB52(1)
         ----------->HVH21
        <-----------HVH21          --------->HSFB2a(2)
       <---------ANAC55(2)--------->ARR14(2)
       --------->ANAC55(2)<---------ARR14(2)                >>>>>>>>>MYB2
       <---------O2       --------->KAN4(2)          ----------->GT1                 <---------ARR14(2)
       --------->O2      --------->KAN1          --------->ANAC58                    --------->ARR14(2)
       --------->TGA1a   --------->KAN4(1)       --------->ANAC58                    <---------ARR11(3)
       <---------TGA1a   <---------KAN4(1)    --------->GATA12                       <---------GATA12
   <---------MYB52(2)    --------->HSFB2a(1)  <---------GATA12            <-----------GT1    -------
  --------->ANAC58       <---------HSFB2a(1)  <---------GLK1(2)        <---------AHL12(2)   <-------
  --------->ANAC46       <----------TaMYB80   <---------ARR11(2)  --------->YAB1     --------->GATA12
  --------->ANAC58      ----------->ARR10     <---------ARR14(2) <---------ATHB12    <-----------ARR10
------->ANAC58          ---------->TaMYB80    --------->ARR14(2)------>MYB83         --------->ARR11(3)
------->ANAC58          <---------KAN4(2)     --------->ARR11(2)------>MYB46(1) ----------->GT1
=================bZIP_DOF<---------KAN1       <---------RVE1(2)--------->WOX13(1)   <---------CCA1(2)
 
agcgcaagaaacgtgacgggcaaggggaatattctcatctagagagttggattcgcaagtgaaaaccaatcaagaatttactcttgtaaatcttcccgtg  2970600
                                                            <----------DOF2
                                                       --------->At4g35610
                                                       <---------At4g35610
                                                     <-----------RAV1(2)
                                                    <------ZmHOX2a(2)
                     <---------DOF5.7(1)           <-----------HVH21
                   <---------ANAC58                <---------ARR14(2)
        <---------KAN1           <---------YAB1    --------->ARR14(2)
       ------->TEIL<---------ANAC46    <---------ANAC55(2)  <---------DAG2
       <---------GATA12          ----------->TBP   <---------ARR11(2)
       --------->GATA12      <----------DOF2       --------->GATA12
    --------->DEAR3(1)      <---------DOF5.7(1)    <---------GATA12
   --------->ANAC46<---------ANAC58   <-------TEIL --------->ARR11(2)                    <------NtERF2
  <---------At5g28300<---------MYB52(1)--------->ANAC55(2)<-------TEIL                  --------->LBD16
-->LBD16--------->At4g35610------>ZmHOX2a(1)     --------->DEAR3(1)  *TSS              --------->DEAR3(1)
--ANAC46<---------At4g35610================================HOX2a_HOX2a                <---------LBD16
 
gtcttcaccgcatctgactattccgttttcctctttataaatacgtttctcgccgatcaggtgctttttgttcgtattgtcaagttttcgccggagaatt  2970700
                                                                                     ===============
                                                                                     ------>ZmHOX2a(2)
                                                                                    ================
                                                                                    <---------GLK1(1)
                                                                                    --------->GLK1(1)
                                                                                    <------ZmHOX2a(2)
                                                                                   --------->GATA12
                                                                                   <-----------ARR10
                                                                                   <---------AGP1
                                                                                   <---------GATA12
                                                                                   --------->RVE1(2)
                                                                                   --------->ARR11(3)
                                                                                   <---------ARR11(3)
                                                                                   <---------ARR14(2)
                                                                                   --------->ARR14(2)
                                                                                   --------->AGP1
                                                                                  <---------CCA1(2)
                                                                                  <---------At4g35610
                                                                            --------->AHL12(1)
                                                                            <---------AHL12(1)
                                                                           --------->AHL20(3)
                                                                           <---------AHL12(1)
                                                                           --------->AHL12(1)
                                                                           --------->AHL25(2)
                                                                           --------->AHL20(1)
                                                                           <---------AHL12(2)
                                                                           --------->ARR11(3)
                                                    --------->ALFIN1       <---------AHL20(3)
                                                 <---------DEAR3(1)        <---------AHL20(1)
                                               --------->LBD16             <---------ARR11(3)
                                              <---------HSFB2a(2)          <---------AHL25(2)
                                             <---------LBD16              --------->AHL12(3)
                                           <---------ARR14(2)             --------->AHL12(2)
                                           --------->ARR14(2)             <---------AHL25(2)
                                          --------->ZAT2                  --------->AHL25(2)
                                          <---------ZAT2                  <---------AHL12(3)
                                          --------->At4g35610             <---------AHL12(2)
                --------->At4g35610       <---------At4g35610           --------->AHL25(2)
               <---------ARR11(3)         --------->HSFB2a(1)           --------->AHL20(2)
               --------->RVE1(2)          <---------HSFC1(2)            --------->AHL12(3)
               <---------GATA12           <---------HSFB2a(1)           <---------AHL12(3)
      --------->ZAT6                      --------->HSFC1(2)            --------->AHL20(3)
 <---------ANAC55(2)                     ----------->ARR10              <---------AHL20(3)
 --------->ANAC55(2)                   <------ZmHOX2a(1)                --------->AHL25(1)
 
catcacttaacacttcaacatctgaaattcaaaatgcctcgaggaagctccggaggtgagtcttctcgttttaaaaaaaatattcagatctcttccttca  2970800
                     <---------ARR14(2)
                     <---------MYB52(1)
                     --------->ARR14(2)
                    <---------RAP2.6(3)
                   <---------ANAC58
                   <---------ANAC58
                  --------------->AtSPL3
                 <---------At5g28300
              <---------KAN1
              <---------GLK1(1)
              --------->GLK1(1)
             --------->ARR11(2)
             <---------GATA12
             --------->ARR14(2)
             <---------RVE1(2)
             <---------ARR14(2)                                   --------->KAN1
            <------ZmHOX2a(1)                                    <---------RVE1(2)
          <---------TOE1(3)                              <---------ALFIN1
          <---------TOE2(3)                             <---------ZAT18
      --------->WOX13(2)     --------->GATA12           --------->ZAT14
      <---------WOX13(2)     <---------GATA12           <---------ZAT14                       <-----
 ----------->GT1<-----------GT1            --------->At5g28300  --------->YAB1    <-----------RAV1(1)
===================HOX2a_HOX2a          --------->At4g35610    <---------YAB1     <---------REM1(1)<
===================HOX2a_HOX2a<---------ATHB12         ------>ZmHOX2a(1)------>ZmHOX2a(1)     ------
 
cattgggttatttaaggatttgccgttcttccaatctagggtttgctgtaatttgttcctgcacttgtgataatcctctcatatgatgttgcaagttgtg  2970900
                              ------>ZmHOX2a(1)
                            ----------->RAV1(2)
                            <---------At4g35610
                   <---------AHL12(2)
                  --------->ARR11(3)
                  <---------ARR11(3)
                  --------->AHL20(3)
                  --------->AHL12(1)
                  --------->AHL20(1)                                    --------->O2
                  <---------AHL20(3)                                    <---------O2
                  <---------AHL20(1)                                    <---------TGA1a
                  <---------AHL25(2)                                    --------->TGA1a
                 <---------KAN1                      <---------TOE2(3) <------NtERF2
      --------------->AGL15 --------->At4g35610      <---------TOE1(3)------>NtERF2
<---------ARR11(3)--------->AHL25(2)         <-------MYC2            ----------->HVH21
--------->ARR11(3)<---------AHL12(1)         ------->MYC3            <---------ETT(2)             <-
----ZAT6         <---------AHL12(1)          <-------MYC3    --------->YAB5                     ----
---------CCA1(2) --------->AHL12(1)          <-------MYC4   <---------YAB1            <---------RVE1(2)
----->GT1       --------->GLK1(2)            ------->MYC2   <---------YAB5  ----------->GT1    <----
 
ttatatcttccgattagagaatattttagtctcctgagcgattttgcacatgttttagggtttatgattctggcgacgagggaaaaattgatttttgtgt  2971000
                           --------->DEAR3(2)
                          <---------At5g28300
                          --------->MYB52(1)
                          -------->P
                       <---------STY1(2)
                    ------>ZmHOX2a(2)
                    ====================HOX2a_HOX2a
                   <------ZmHOX2a(2)
                   --------->CCA1(2)
                   =====================HOX2a_HOX2a
                  --------->ARR11(3)
                  <-----------ARR10                               ------>ZmHOX2a(1)
                  --------->ARR14(3)                           ------>NtERF2
                  --------->GATA12                            --------->DEAR3(1)
                  --------->RVE1(2)                           <---------ALFIN1                  <---
                  <---------GATA12                          ------>NtERF2                       ----
                  <---------ARR14(2)                       --------->ANAC58                     <---
                  <---------ARR14(3)                --------->ANAC58                            ----
                  --------->AGP1              --------->At4g35610 <---------------AGL15         ----
                  <---------ARR11(3)          <---------At4g35610--------->TOE2(3) <-----------GT1
                  <---------AGP1 ------>ZmHOX2a(1)  --------->ANAC58 --------->GATA12           <---
                  --------->ARR14(2)          <---------ZAT2<---------ATERF1(1) --------->YAB1  <---
   --------->AHL12(1)  --------->STY1(2)      --------->ZAT2<------NtERF2----------->GT1        <---
--------WOX13(1)  <---------ARR11(2)       <---------ZAT2  --------->ANAC46   <---------YAB1   <----
----->ATHB12  <------ZmHOX2a(1)<---------DOF5.7(1)  --------->ANAC46 <---------GATA12 --------->TOE2(3)
-----YAB1     =============HOX2a_HOX2a    --------->AtLEC2 --------->ANAC58 >>>>>>>>>GT-1      -----
 
gattgaatttttgtgcaggaagatctagctaccgtccttctcgccctgcagctgcacgaagcccgcctcctcaatctggttaatattaacctcactgaat  2971100
       <---------RVE1(2)
       >>>>>>>>>ARR2
     <---------YAB1
  <---------RVE1(2)
 --------->ATHB12                                                                       --------->ZAT2
------AHL12(1)                                                                          <---------At4g35610
----->AHL12(1)                                                                          --------->At4g35610
------AHL20(2)                                                                   --------->ANAC46
----->AHL25(1)                                                             ------>ZmHOX2a(1)
----->AHL25(2)                                                            <---------ALFIN1
------AHL25(1)                  --------->ANAC55(2)                <---------ANAC58   --------->MYB46(3)
------AHL20(3)   --------->ARR11(3)                                <---------ANAC58 ----------->RAV1(1)
------AHL25(2)   <---------ARR11(3)               <---------LBD16------->TEIL    --------->ANAC58
-----AHL12(1)    <---------GLK1(2)  --------->WOX13(2)         --------->ZAT14   --------->ANAC58
---->AHL12(1)    <---------RVE1(2)<---------AHL20(2)           <---------ZAT14------>ZmHOX2a(1)
 
tttttgatttgattgtataagattttgctctgtttatgtaattgtgttttgtttctgggttttcagtgaaccgtgctcctcctccagcaacagctcagcc  2971200
<- Previous    Next ->

AGI:  At5g09570.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G64400.1); similar to unknown [Populus trichocarpa] (GB:ABK94558.1); contains InterPro domain CHCH (InterPro:IPR010625)
Range:  from: 2970670    to: 2972182    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version