AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
    --------->At4g35610                     ------>ZmHOX2a(2)                  --------->SPL1(1)
    <---------ZAT2                         --------->GLK1(1)                   <---------SPL1(1)
    <---------At4g35610                    <------ZmHOX2a(2)                  <---------SPL1(2)
    --------->ZAT2                        <---------GATA12                    <---------SPL7(1)
   ------>ZmHOX2a(1)                      --------->GATA12                ------------------>SPL14
   <-----------RAV1(1)                <-----------GT1                <----------DOF2
-------->ARR14(2)       <-----------------AGL1                      <---------DOF5.7(1)
-------->ARR11(2)<------ZmHOX2a(1)   <---------ARR11(2)   <---------------AtSPL8
---------ARR11(2)==================================HOX2a_HOX2a     <---------DAG2
---------ARR14(2)=================================HOX2a_HOX2a   <---------ALFIN1
--->MYB52(1)<-----------HVH21       <---------GLK1(1)     --------------->AtSPL3--------->ZAT14
--ATHB12<-----------------AGL1     ---------->TaMYB80     --------------->AtSPL8<---------ZAT14-----
->MYB46(3)--------->LBD16   <---------MYB52(1)            <---------------AtSPL3--------->SPL7(1)
cggttcctgctgcccggttaggacgcgaaccgtttgggtatttccgatctctaggtgagaagaagtaccactctttctctccgtacagagacatctctga  2859900
                                                      --------->AHL12(2)               <---------HSFC1(2)
                                                      --------->AHL12(3)               --------->HSFC1(2)
                                                      --------->AHL20(3)               --------->ZAT2
                             --------->HSFB2a(2)      <---------AHL12(3)               <---------ZAT2
                          --------->GLK1(2)          <---------AHL12(2)                --------->At4g35610
                         <---------GLK1(2)           --------->YAB1                    <---------HSFB2a(1)
                     --------->MYB52(1)        <---------HSFB2a(2)                     <---------At4g35610
         <---------ARR11(3)  <---------HSFB2a(2)     --------->AHL12(2)                --------->HSFB2a(1)
         --------->ARR11(3)  <---------HSFC1(1)--------->HSFB2a(2)                <---------HSFB2a(2)
    --------->MYB46(3)  --------->YAB5        <---------ANAC46                   <---------LBD16
 <----------ID1--------->WOX13(2)        --------->ATHB12--------->WOX13(2)    ------->TEIL
----->DOF2     <---------WOX13(2)     --------->ANAC55(2)<---------WOX13(2) <---------REM1(1)  <----
aagaagaacaaacatctcaataaacaacgattctcgaagacacatgatttcgcgaaaaataattagaagaagcccataggtgtacctggaagctcccaag  2860000
                                       <---------GLK1(1)      --------->LBD16
                                       --------->GLK1(1)      ------>NtERF2
                                  ------>NtERF2              <---------ETT(1)
                                  --------->ZAT2             --------->HSFB2a(2)                 <--
                                  --------->At4g35610        --------->ANAC46                    ---
                                  <---------ZAT2             <---------ATERF1(2)               <----
                                  <---------At4g35610        <---------HSFB2a(2)              <-----
                                 --------->ARR11(2)         <---------LBD16                  <------
                             <---------LBD16--------->ZAT2<---------ARR14(2)                --------
                            --------->MYB52(1)            <---------ARR11(2)             --------->TOE1(1)
                          --------->KAN1<---------RVE1(2) --------->ARR11(2)            ------>ZmHOX2a(1)
                      <------NtERF2<------NtERF2          --------->ARR14(2)           <---------ALFIN1
                    <---------DEAR3(1)----------->ARR10  --------->GLK1(1)        --------->ANAC58
               --------->WOX13(1)<---------ARR11(2)      <---------GLK1(1)        --------->ANAC58<-
             <------ZmHOX2a(2)   --------->ARR14(2)    <---------KAN1         <-----------GT1-------
            <---------ARR11(3)   <---------ARR14(2)--------->ANAC58        <---------KAN1--------->TOE2(1)
-----ATHB12 --------->ARR11(3) --------->LBD16     --------->ANAC58      <---------GLK1(2)<---------
gattgaacttgtagagatcaatctcggcgataaccggagccgagatctgctcggaagcacatttccggcacaagtagaatttcacaagctcctcgtccgt  2860100
                       --------->WOX13(2)                                             --------->MYB55(2)
                       <---------WOX13(2)                                             <------MYB46(1)
         <---------ARR14(2)                                                           <------MYB83
-------MYB46(3)   ----------->GT1                                                    <---------AtMYB61
------>MYB55(2)<---------ZAT2                                            --------->RVE1(1)
-----MYB52(1)  --------->At4g35610                                      --------->RVE1(2)
--GAMYB  --------->ARR14(2)                                             --------->GLK1(2)
---MYB46(3)    <---------At4g35610                                      <---------ARR11(3)
->SPL7(1)--------->ARR11(2) <---------At4g35610          <-------GAMYB  --------->ARR11(3)
--------AtLEC2 --------->ZAT2                            <---------At4g35610         <---------TOE1(2)
-->MYB52(2)  <-----------RAV1(2) ------>NtERF2          <-----------RAV1(1)          <---------TOE2(2)
--HVH21  <---------ARR11(2) --------->At4g35610         <---------MYB46(3)          <---------MYB52(1)
tggatggaatcggaacccagctggtaaatttagctccgacttcattctcttcttcttgtctgttgctcttggaaaaatctcttcttcgttggttgaaaat  2860200
            ------>ZmHOX2a(2)                                             <---------DEAR3(1)
          <---------ARR11(3)                                              <----------ID1
          --------->ARR14(2)                                              ----------->HVH21
          --------->ARR11(3)                                              --------->DEAR3(1)
          <---------ARR14(2)                                             --------->ATERF1(1)
          --------->ARR11(2)                                  *TSS   --------->ALFIN1
          <---------RVE1(2)                                  <---------KAN1------>NtERF2
          <---------ARR11(2)                                 --------->CCA1(2)
          <---------GATA12                                   --------->GLK1(1)                ------
          <---------AGP1                                     <---------GLK1(1)                ------
          --------->GATA12                                  <---------RVE1(2)               <------ZmHOX2a(1)
     <---------At4g35610                                    <---------ARR11(2)   --------->HSFB2a(1)
     <---------ZAT2<---------AHL20(2)                       --------->ARR14(2)  <---------TOE1(2)
     ----------->RAV1(2)                     <---------YAB1 <---------ARR14(2)  <---------TOE2(3) <-
     --------->At4g35610                <---------At4g35610 --------->ARR11(2)  <---------TOE2(2)---
     --------->ZAT2<---------AHL12(3)   --------->At4g35610<------ZmHOX2a(1)<------NtERF2  <--------
tcaatttcagctggatctggattttttttgggttttcttcgtctgctcaagattgtaatcgaggatatgtgagtgaggcgacgaaggttttataaggacg  2860300
                   <---------AHL20(2)                                             --------->SPL7(1)
                   --------->AHL20(2)                                            --------->ALFIN1
                   <---------AHL25(3)                                           <-------MYC3
                   --------->AHL20(3)                                           <-------PIF4
                   --------->AHL12(3)                                           ------->PIF4
                  <---------AHL25(3)                                            ------->MYC3
                  --------->AHL12(3)                                            ------->MYC2
                  <---------AHL20(1)                                            <-------MYC2
                  <---------AHL12(1)                                            <-------MYC4
                  --------->AHL25(3)                                            ------->PIF5
                  --------->AHL25(2)                                 --------->GLK1(1)
                  --------->AHL25(1)                                --------->ARR14(2)
                  <---------AHL25(2)                                <---------ARR14(2)
                  --------->AHL12(1)                                <---------GATA12
                  <---------AHL25(1)                                <---------RVE1(2)<------NtERF2
                  <---------AHL12(3)                         --------->O2       <-------PIF5
                  <---------AHL20(2)                         --------->TGA1a    ------->MYC4
                  --------->AHL20(2)                         <---------TGA1a   <---------TGA1a
                 --------->AHL25(3)                     ----------->HVH21      =====================
                <---------WOX13(2)                    --------->CCA1(2)       ------------>OsbHLH66
                --------->WOX13(2)                    --------->At4g35610    <------------OsbHLH66
--->ANAC58      --------->AHL12(2)                 --------->DOF5.7(1)     --------->ANAC58
--->ANAC58    <---------YAB1----------->GT1      ========================================bZIP_DOF
--------KAN1  <---------AHL20(2)                 ---------->DOF2    --------->GATA12----------->GT1
------->DOF2  --------->AHL20(2)                 ======================bZIP_DOF--------->TGA1a    <-
--ID1         --------->AHL25(1)           --------->MYB52(1)<---------O2  --------->ANAC58       xx
aaaatcgccgaaatgttttaattaatttaaattgaaaaaacacaaaaaacagaaaagagatgacacgaggggattttcaagcacgtgcggcaaaacagac  2860400
                         <---------ZAT2   --------->bZIP60(1)
                         --------->At4g35610    <---------AHL20(3)
                         <---------At4g35610  <-----------------AGL3
                         --------->ZAT2   <---------bZIP60(1)
                     ------>NtERF2        <---------ANAC58
                    --------->RAP2.3(3)   <---------ANAC58
                    --------->DEAR3(1)    <---------ANAC55(2)                         <-----------HVH21
                   --------->ERF1         <---------ANAC46                           <---------ANAC58
              ------>NtERF2              <------NtERF2                               <---------ANAC58
             --------->WRKY38(1)     <---------O2<---------AHL25(1)                  --------->bZIP60(1)
             --------->WRKY12        --------->ANAC55(2)                         <---------ANAC58
             ----------->HVH21      <-------TEIL--------->AHL25(2)               <---------ANAC46
           <---------At4g35610   --------->KAN1 <---------AHL20(1)   --------->ARR11(3)           <-
           --------->At4g35610   --------->CCA1(2)--------->ATHB12   <---------RVE1(2)<-----------TGA1
          --------->ANAC46  ----------->GT1   ======================================================
   <----------DOF2<---------At4g35610--------->ANAC46    --------->KAN1 ----------------------->TaNAC69(2)
==============bZIP_DOF <-----------RAV1(2)--------->ANAC55(2)<---------ZAT18     <---------ANAC58<--
--------MYB52(1)  --------->At4g35610<---------ANAC58   --------->ARR11(2) <---------YAB5        <--
xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)<---------ANAC58   <---------RVE1(2)  <---------YAB1 <---------ANAC55(2)
cgttttcttttctacgctgaccgcagccagctggatatatacgtggcgtaatattattggatagtcgacttagatgttgtcattgcttgcgtcacttaaa  2860500
                   <----------DOF2                                                       --------->ANAC46
                 ------>MYB83                   --------->ZAT14                          <xxxxxxxxxx
              -------->ZAP1                    ----------->GT1                           --------->ANAC58
            <---------WRKY18(1)          --------->DOF5.7(1)                             --------->ANAC58
           --------->ETT(2)  <-----------------AG                                    <-----------GT1
           --------->WRKY12  --------->RVE1(2) --------->ALFIN1<---------ANAC58    <----------DOF2
---------DOF2 --------->DEAR3(2)       ---------->DOF2     <---------ANAC58    --------->ARR11(3)
===============================================MADS_MADS   <---------ANAC58    <---------RVE1(2)  <x
-------DOF5.7(1) ------>MYB46(1) xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)   <----------DOF2 <xxxxxxxxxx
-------DAG2--------->WRKY38(1)  --------->ATHB12<---------ZAT14<---------ANAC58<---------ARR11(3)<--
ccttttgtgaattgttgaccgactttagaccatctccattgggaaagagagtgtagaaagtttcttacttgagaaactttgagatactttacaacccatc  2860600
                                                               --------->WOX13(2)    <---------AHL25(2)
                                                              --------->AHL12(2)     <---------AHL20(2)
                                                              <---------AHL12(2)     --------->AHL12(3)
                                                             --------->AHL20(2)      <---------AHL12(3)
                                                             --------->AHL20(1)      --------->AHL20(3)
                                                             <---------AHL12(3)    --------->AHL12(3)
                                                             <---------AHL20(2)    <---------AHL12(3)
                                                             --------->AHL25(2)    <---------AHL25(2)
                                                             <---------AHL25(2)    --------->AHL25(2)
                                                             --------->AHL20(3)    --------->AHL12(2)
                                                             <---------AHL25(3)    <---------AHL12(2)
                                                             <---------AHL25(1)   --------->AHL25(2)
                                                             <---------AHL20(3)   <---------AHL25(3)
                                                             --------->AHL25(1)   --------->AHL20(3)
                                                            <---------AHL25(2)    --------->AHL20(1)
                                                            --------->AHL25(1)    <---------AHL20(1)
                                                            --------->AHL25(3)    <---------AHL20(3)
                                                            <---------AHL25(3)    --------->AHL12(1)
                                                            <---------AHL12(3)    <---------AHL25(2)
                                                            <---------AHL25(1)   --------->AHL12(1)
                                                            <---------AHL20(2)  <---------AHL12(2)
                                                            --------->AHL12(1)  --------->AHL12(2)
                                                            <---------AHL12(1)  <---------TOE2(3)
                                                            --------->AHL12(3) <---------AHL20(2)
                   <---------MYB46(3)                       --------->AHL20(2) --------->AHL20(2)
    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)                  --------->WOX13(2)   --------->AHL12(3)
  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)                    <---------AHL12(2)   <---------AHL25(2)
-----ICU4<---------At4g35610                             --------->YAB5        --------->AHL20(3)
xxxxxxxxxxxxxxxxsmallRNA(fl3)                            <---------AHL25(3)    --------->YAB1
xxxxxxxxxxxxxxxxxxxsmallRNA(fl3)                        <---------AHL20(2)     <---------AHL12(3)
xxxxxxxxxxxxxxsmallRNA(le3)                             --------->AHL25(1)     <---------AHL20(3)
---->YAB1--------->At4g35610                            --------->AHL20(2)   --------->AHL20(3)
xxxxxxxxxxxxxxxxxxsmallRNA(si3)                         <---------AHL12(3)   <---------AHL20(2)
xxxxxxxxxxxxxxx>smallRNA(se3)                           <---------AHL25(1)   --------->AHL25(2)
---->YAB5<xxxxxxxxxxxxxxxxxxxsmallRNA(i2)               <---------AHL12(1)   <---------YAB1
----ATHB12<---------DOF5.7(1)                           --------->AHL12(3)   --------->AHL20(2)
xxxxxxxxxxxsmallRNA(si3)                                --------->AHL25(3)   --------->AHL12(3)
xxxxxxxxxxxxxxxxxsmallRNA(i2)                           <---------ATHB51     <---------AHL20(3)
xxxxxxxxxxxxxxxxxsmallRNA(si3)                          --------->ICU4       <---------AHL12(3)
xxxxxxxxxxxxxxxxxsmallRNA(le3)                          --------->AHL12(1)  --------->YAB1
xxxxxxxxxxxxxsmallRNA(se3)                            <---------AHL12(2)  <---------AHL25(2)
xxxxxxxxxxxxxxxxsmallRNA(se3)                         --------->AHL12(2)  --------->AHL25(2)
xxxxxxxxxxxxxxsmallRNA(s2)                           <---------AHL20(2)   <---------AHL20(2)
xxxxxxxxxxxxxxsmallRNA(i2)                           <---------AHL25(3)   --------->AHL20(3)
xxxxxxxxxxxxxxx>smallRNA(i2)                        --------->AHL20(3)    <---------AHL20(3)
xxxxxxxxxxxxxxxxsmallRNA(si3)                       --------->AHL12(1)   --------->YAB1
xxxxxxxxxxxxsmallRNA(s2)                            <---------AHL20(2) --------->AHL25(3)
xxxxxxxxxxxxxxsmallRNA(i2)                          --------->AHL20(2) --------->AHL20(2)
xxxxxxxxxxxxsmallRNA(si3)                  <---------DAG2<---------ICU4<---------AHL20(1)
xxxxxxxxxxxxxxsmallRNA(si3)                <----------DOF2<---------WOX13(2)--------->TOE2(3)
xxxxxxxxxxxxxxxsmallRNA(si3)    <-----------GT1     <---------AHL25(3) --------->AHL20(1)
xxxxxxxxxxxxxsmallRNA(si3) --------->AHL25(2)       <---------AHL12(1) <---------AHL25(2)
xxxxxxxxxxxx>smallRNA(le3) --------->AHL20(2)       --------->AHL12(3) <---------AHL20(2)
xxxxxxxxxxxxxxsmallRNA(si3)--------->AHL25(3)       --------->AHL25(3) --------->AHL20(3)
xxxxxxxxxxxx>smallRNA(si3) <---------AHL25(2)       <---------AHL12(3) --------->AHL25(2)
xxxxxxxxxxxxxxsmallRNA(fl3)--------->AHL20(3)       <---------AHL25(1) <---------AHL25(1)
xxxxxxxxxxxxxsmallRNA(le3) <---------AHL20(2)       --------->AHL25(1) --------->AHL25(1)
xxxxxxxxxxxxxsmallRNA(le3) --------->AHL25(1)     <---------WOX13(2)--------->YAB1<---------AHL12(1)
xxxxxxxxxxxxxsmallRNA(si3) --------->AHL12(1)     --------->WOX13(2)--------->AHL20(2)
xxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)    --------->YAB1<---------AHL20(3) <---------AHL20(3)
xxxxxxxxxxxxsmallRNA(le3)  <---------AHL12(1)   --------->AHL20(2)<---------AHL20(2) <---------AHL20(3)
-------YAB1   <---------YAB1 <---------AHL12(2) <---------AHL20(2)<---------AHL25(2) <---------AHL25(1)
atgacaattctcatcttactattggttcaattttttaacaaaaatacttttttaattaaataattaaattataatataatattaatattttttttgtttg  2860700
                xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)                         <----------DOF2
              --------->HSFB2a(2)                                     <---------ANAC58          ----
              <---------HSFB2a(2)                                     <---------ANAC58        ------
          <---------GLK1(1)           <-----------HVH21              <---------At4g35610   <--------
          --------->GLK1(1)    <----------DOF2                    --------->ZAT14          <--------
         --------->GATA12--------->KAN1                ------>ZmHOX2a(1)      <---------DOF5.7(1)
       xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)         ----------->RAV1(2)  ---------->ID1<---------MYB52(1)
     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)     <---------MYB52(1) <---------ZAT14      <----------DOF2
    <---------ANAC46    --------->ARR11(2)   --------->TOE2(3)   --------->ALFIN1  ---------->ID1
agaaattttgtggatttctcgtagatggaaatgcctttatatgtcaaaccgtaatctcctgcttctcagtgtagcttatcgcttttgttcctttacttac  2860800
<- Previous    Next ->

AGI:  At5g08790.1   
Description:  ATAF2 (Arabidopsis NAC domain containing protein 81). similar to ANAC102 (Arabidopsis NAC domain containing protein 102), transcription factor [Arabidopsis thaliana] (TAIR:AT5G63790.1); similar to NAC-domain protein 3 [Brassica napus] (GB:AAP35049.1); contains InterPro domain No apical meristem (NAM) protein; (InterPro:IPR003441)
Range:  from: 2858850    to: 2860263    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version