AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                              <---------ANAC58
                                              <---------ANAC58
                                           --------->GLK1(2)
                                          <---------ARR14(2)
                                          <---------GATA12
                                          --------->GATA12
                                          --------->ARR14(2)
                                      <------NtERF2
                                      --------->ATERF1(1)
                                     ------>NtERF2
                                    --------->RAP2.3(3)
                                    --------->RAP2.3(2)
          <----------DOF2           --------->DEAR3(1)
         <---------DOF5.7(1)       --------->RAP2.3(1)
        <---------ZAT2             --------->ATERF1(1)
        <---------At4g35610        --------->RRTF1(1)
        --------->ZAT2             --------->ERF1
        --------->At4g35610       <---------ATERF1(1)                                 ----------->RAV1(2)
        <------NtERF2             --------->LBD16                                     <---------At4g35610
   --------->DAG2             --------->ARR14(2)                                      --------->At4g35610
   --------->DOF5.7(1)        --------->ARR11(2)                            --------->ATERF1(1)
  ---------->DOF2             <---------ARR14(2)                            <---------YAB5        <-
  --------->DAG2              <---------ARR11(2)                     --------->GLK1(2)--------->ZAT2
  --------->DOF5.7(1)  --------->ARR11(2) <---------GLK1(2)          --------->ARR14(2)           <-
 ---------->DOF2  <---------ALFIN1<---------RAP2.3(1)                <---------ARR11(2)         ----
 --------->DOF5.7(1)   <---------ARR11(2)--------->KAN1         --------->LBD16       <---------ZAT2
-->ANAC55(2)      ----------->RAV1(1)----------->RAV1(1)      <---------LBD16         ==============
---HSFB2a(2)   --------->ANAC58  --------->ANAC46--------->At4g35610 <---------ARR14(2)      -------
-->HSFB2a(2)   --------->ANAC46 --------->SPL7(1)--------->ZAT2--------->LBD16      <-----------RAV1(2)
---ANAC55(2)   --------->ANAC58 <---------LBD16  <---------ZAT2--------->HSFB2a(2)  ================
 
aacaaaaaggcagctttctcgccacagttccagcatccggcgccagattccgagcagaaaactctcccggagaatcggagtcgtccctcagctgaagaat  1961000
            <---------HSFB2a(2)
         --------->ARR14(1)
         --------->CCA1(2)                                                 <------MYB83
         --------->GLK1(2)                                                 <------MYB46(1)
        <---------GATA12                                                  --------->MYB59
        <---------RVE1(2)                                               --------->ARR11(2)
        --------->GATA12                                                <---------ARR11(2)
        --------->ARR11(1)                                           <---------TOE2(3)
        --------->ARR11(2)                                      --------->At4g35610
        <---------ARR14(2)                                      <-------GAMYB
        --------->ARR14(2)                                      <---------WOX13(2)
        <---------GLK1(2)                                       --------->WOX13(2)
      ----------->ARR10          <---------WOX13(1)            <---------MYB46(3)
----------RAV1(1)              --------->ATHB12                --------->MYB52(2)
--------REM1(1)               <---------YAB1                   --------->MYB46(2)
----->YAB1<-------TEIL        <---------YAB5       <---------WOX13(2)<---------TOE1(3)
==========RAV           <---------ANAC58    <---------ANAC46 <---------MYB52(1)<---------ANAC46<----
-->YAB1--------->KAN1   <---------ANAC58<-----------HVH21    <--------P<------ZmHOX2a(1)--------->DOF5.7(1)
==========RAV       <---------WOX13(2)<---------YAB5       <---------MYB46(3) <-------TEIL  --------
 
gatgttgcagagattcgcgaggcaattgggtttgtgattgaatcgtcgcgagtgaattacactggttagttgaaggataggtccgtctaataagggtgga  1961100
                                        ==============================HOX2a_HOX2a
                                        ===============================HOX2a_HOX2a
                                     <-----------RAV1(2)
                                    <------ZmHOX2a(2)
                                   --------->GATA12                        --------->YAB5
                                   <---------ARR11(2)              <---------ANAC46
                                   <---------GATA12            <------ZmHOX2a(2)
       --------->MYB46(3)          --------->ARR11(2)         <---------RVE1(2)
      ------>NtERF2            --------->ANAC55(2)            <---------GATA12
     --------->RAP2.6(2)       <---------ANAC46               <---------ARR11(3)
  --------->ANAC46             <---------ANAC55(2)            --------->GATA12
  --------->ANAC58            <---------LBD16         <---------LBD16   <---------ARR11(2)
  --------->ANAC58         <---------WOX13(2)       <---------RVE1(2)  <---------CCA1(2)
-----RVE1(2)               --------->WOX13(2) <---------ARR14(2)------>ZmHOX2a(2)
->ALFIN1--------->AtMYB61 <---------ICU4<------ZmHOX2a(1) *TSS--------->ARR11(3)             -------
 
gatggaagccaccatcgtcttcgttttcttcattacgggatcaggagaggttttggctctggagagatcgtcgtgtatcgattactactactacttgtcc  1961200
                                                     <-----------GT1
                                                   <---------AHL20(3)
                                                   <---------AHL12(2)
                                                   --------->AHL12(2)                 <---------DOF5.7(1)
                                                   --------->AHL20(3)                ------>NtERF2--
                                                 <---------CCA1(1)            <---------ARR14(2) ---
                                                 <---------RVE1(1)            --------->ARR14(2) ---
                                                <---------ARR14(2)           --------->KAN1      <--
                                                <---------ARR11(3)          ----------->ARR10  -----
                          <---------ANAC46      --------->ARR14(2)         <---------KAN1      <----
                  <------------CBF     --------->AtMYB61      <---------SPL7(1)      <---------At4g35610
                  <---------WOX13(2)  ----------------->AGL2--------------->AtSPL3  --------->DEAR3(1)
               <---------KAN1  <-----------GT1  --------->ARR11(3)       ----------->GT1      ------
--->ID1      ----------->GT1<---------ZAT6      <---------RVE1(2)----------------->AGL1 <---------KAN1
 
ctaatcgaaccagaccgagtaaattggtttagtgttacaagaccaaaaccagatatttatcttatcgtaccagaccgagtaaattcgccgcttatcgcct  1961300
       ----------->GT1
      <---------DEAR3(1)
     --------->SPL7(1)                      --------->LBD16
   --------->LBD16                         ------->GAMYB
   ----------->HVH21                      <---------LBD16
   <---------SPL7(1)                     -------->P
 <---------LBD16                       <---------WRKY38(1)
---->NtERF2 <---------ARR11(2)       <-----------HVH21
------>DEAR3(1)     --------->ARR11(3) <---------WRKY12
-------->HVH21      <---------ARR11(3)--------->WRKY18(1)      <---------ANAC58
-------ETT(1)      <---------KAN1  --------->LBD16             <---------ANAC58
->NtERF2--------->At5g28300      <---------LBD16         <---------TOE1(3)   ------------>CBF
-----ATERF1(1)--------->YAB1    --------->MYB52(1)       <---------TOE2(3)  ------>ZmHOX2a(1)
--->DEAR3(1)<---------GATA12 <-----------HVH21<-----------HVH21<---------ANAC46     <---------YAB1 -
 
ccgacccggacggtgaatcggaataccttctgggttaccgggtcaaccgggtcactgggtaaggtttcgttttcttctcctccaattctcatttcatctt  1961400
                                          <---------ICU4
                                         <---------YAB5
                                         <---------ATHB12
                                       <---------GLK1(1)
                                       --------->GLK1(1)                                      ------
                               <---------YAB5                                                 <-----
                              <-----------HVH21                                  <----------DOF2
                          --------->HSFC1(2)                          <---------HSFC1(2)      <-----
                          <---------HSFC1(2)        <XXXXXXXXXXXXXXXXXXXXMIR851-3P           -------
           *TSS<---------TOE2(3)  <---------At4g35610         --------->KAN1----------->RAV1(2)
          --------->YAB5  <---------HSFB2a(1)  <---------ANAC58       --------->HSFB2a(1)  <--------
--------->GLK1(1)         --------->HSFB2a(1)  <---------ANAC58       <---------HSFB2a(1)  ---------
<---------GLK1(1)      <------ZmHOX2a(1) --------->ICU4    <---------MYB46(3) ------>ZmHOX2a(1)
-------->GATA12<---------TOE1(3)  --------->At4g35610<----------DOF2  --------->HSFC1(2)  <-------TEIL
 
cagatttcttcatcgattagggtttaggaaccttgtcatcggaaatcatttcttgtctttgtttgttattcgaagcttctcctgcttatttgatacatat  1961500
                        --------->YAB5
                        --------->KAN1
                     --------->ARR11(2)
                     <---------ARR11(2)
                  --------->ANAC46
                <---------AtLEC2                                                     ------>ZmHOX2a(2)
               <---------REM1(2)                    --------->ARR11(2)             --------->GATA12
         --------->KAN1--------->MYB46(3)           --------->GATA12               <---------ARR14(2)
        --------->ARR14(2)                          <---------ARR11(2)             --------->ARR11(2)
        <---------ARR14(2)                          <---------GATA12               <---------GATA12
--->ARR14(2)<---------------AGL15                   <---------ARR14(2)             <---------ARR11(2)
----GLK1(2)<-----------------AGL1                   --------->ARR14(2)             --------->ARR14(2)
----ARR14(2)--------------->AGL15              <-----------HVH21              --------->MYB52(1)   <
-->KAN1 --------->ARR11(2)            <------ZmHOX2a(1)            --------->At4g35610  <------ZmHOX2a(2)
-ANAC55(2) --------->ZAT6           <---------TOE1(3)             --------->DEAR3(1)<------ZmHOX2a(2)
>ANAC55(2) <-----------------AGL3   <---------TOE2(3)     <----------DOF2    ----------->HVH21   <--
 
tctctcttccagttactctacatggaaccattcgttgttaaggagaacatcgtcgcatccgcttcttcgccgatgaagaagcgacggatcgatcacactg  1961600
         <---------ARR11(2)
         --------->ARR14(2)
         --------->ARR11(2)
         <---------ARR14(2)
        ----------------------->TaNAC69(2)            --------->CCA1(2)
       <---------MYB46(3)                            --------->ARR11(1)           <---------DOF5.7(2)
   ----------->HVH21                                 --------->ARR14(2)        <------MYB46(1)
 --------->At4g35610                                 <---------ARR11(2)        <------MYB83
 --------->ZAT2                                      <---------ARR14(2)       --------->MYB59
 <---------ZAT2                                      --------->ARR11(2)  <------NtERF2           ---
 <---------At4g35610          --------->ZAT6     <---------DOF5.7(2)    --------->LBD16       ======
 ----------->RAV1(2)<---------TOE2(3)           <---------ARR11(2)     <---------ANAC46       ------
-----------RAV1(2) <-----------GT1            <---------MYB46(3)      <---------LBD16--------->YAB5<
---------HVH21    <---------KAN1          <---------DEAR3(1)     ------->TEIL --------->MYB46(2)----
 
agtcagctgatggttctgcgattaacgcttctaactctagtagcatcggtggtaacgatacggtgatgaacatggcggagtttggtaacgacaactccaa  1961700
                                                                     <---------AHL12(1)
                                                                    <---------RVE1(1)
                                                                    <---------CCA1(1)
   <------ZmHOX2a(1)                                               <---------ARR11(3)
<-----------RAV1(2)                                                --------->ARR11(3)
--------->YAB1                        ------->TEIL                 <---------RVE1(2)               <
------>WOX13(1)                      <---------CCA1(2)           <---------TOE2(3)                 -
============RAV                  <---------ANAC46           --------->ATHB12               ---------
----->RAV1(1)       <---------ANAC55(2)                   --------------->AGL15<<<<<<<<<TBF1      <-
---------ATHB12----------->GT1   <---------ANAC58   <-----------RAV1(1)     <<<<<<<<<TBF1  <--------
----->MYB46(3)<---------TOE2(3)  <---------ANAC58   <---------MYB46(3)  <-----------GT1 <---------MYB52(1)
 
caatcaggagtctcaacaaggttacatatactacttccttgtatctcaattctagttgttgcctcattgagattttttcttcttcttcgttgttagctag  1961800
                     <---------ICU4
                     -------->ATHB1                               ----------->GT1
                     --------->ATHB12                            --------->DAG2
    --------->WOX13(2)                                          ---------->DOF2             --------
  <---------YAB1     --------->YAB5                           ------->GAMYB                 --------
---------AHL12(1)    --------->YAB1                    --------->ANAC58                  --------->ATHB12
-------->AHL12(1)   <---------YAB5                     --------->ANAC58             --------->DOF5.7(1)
>At4g35610     <---------ATHB12                    <---------HSFB2a(2)            ---------->DOF2
--------AHL12(2)    <---------ATHB12               --------->HSFB2a(2)          <------ZmHOX2a(1)  -
-STY1(2) --------->ZAT6                     <----------DOF2--------->MYB52(1)  <----------ID1   <---
 
aaattttcatttacactaatcaaatcattgttctgtttcagtttgcactttcttcaagaagccaacgaaaagtaaaaacataaggaaaagaaccattgac  1961900
<- Previous    Next ->

AGI:  At5g06410.1   
Description:  DNAJ heat shock N-terminal domain-containing protein. similar to unnamed protein product [Vitis vinifera] (GB:CAO39912.1); contains InterPro domain Heat shock cognate protein B, C-terminal oligomerisation; (InterPro:IPR009073); contains InterPro domain Heat shock protein DnaJ, N-terminal; (InterPro:IPR001623); contains InterPro domain Co-chaperone Hsc20; (InterPro:IPR004640)
Range:  from: 1959537    to: 1961159    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At5g06420.1   
Description:  zinc finger (CCCH-type/C3HC4-type RING finger) family protein. similar to nucleic acid binding [Arabidopsis thaliana] (TAIR:AT1G01350.1); similar to Os02g0301000 [Oryza sativa (japonica cultivar-group)] (GB:NP_001046620.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN64331.1); contains InterPro domain Zinc finger, CCCH-type; (InterPro:IPR000571); contains InterPro domain Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); contains InterPro domain Zinc finger, RING-type; (InterPro:IPR001841)
Range:  from: 1961412    to: 1963039    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version