AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                   <------MYB46(1)
                                                                   <------MYB83
                                                                  --------->MYB59            -------
                                                              --------->AHL20(2)           ---------
                                                              <---------AHL20(2)           <--------
                                                              --------->AHL25(1)           ---------
                             <---------------AtSPL8           <---------AHL25(1)           ---------
                     <---------ICU4                          --------->AHL25(3)--------->ATHB12
                    <---------YAB1                       <---------YAB5        <--------ATHB1<------
                    --------->ICU4                 --------->MYB52(2)         --------->ICU4<-------
        --------------->AGL15--------------->AtSPL8<---------MYB46(3)         <---------YAB1--------
---------DOF2     --------->YAB1                ------------>MYB.PH3(2)       <---------YAB5<-------
----ZAT18        <---------YAB5          <-------TEIL <-----------GT1         <---------ATHB12  ----
--->ZAT18<---------YAB1     <---------KAN1 <---------GATA12  --------->AHL20(2)--------->YAB5<------
 
gctttacatttcattatagagtcataatggaatatgtacaaatatacatctagtttgttactcatttatttggtagagacaatgatttgaagaaatatat  1887900
                                               <-----------GT1
                                            <---------AHL12(2)
                                          --------->ICU4
                                         <---------AHL25(2)
                                         <---------AHL12(3)
                                         --------->AHL12(2)
                                         <---------AHL12(2)
                                         --------->AHL25(2)
                                         --------->AHL12(3)
                                        <---------AHL25(3)
      ---------->DOF2                   <---------AHL25(2)
-->AHL12(3)                             <---------AHL25(1)
>AHL25(1)                               --------->AHL25(1)
-AHL12(3)                               <---------AHL12(3)
>AHL20(2)                               --------->AHL12(1)
>AHL12(3)                               <---------AHL12(1)
---AHL12(2)                             --------->AHL25(2)
--AHL25(3)       ------->TEIL           --------->AHL12(2)                                <---------ICU4
->AHL20(1)       --------->GATA12      <---------AHL12(1)           --------->ATHB12    <---------ANAC55(2)
--AHL20(1)  <---------KAN1             <---------KAN1  <-----------GT1       <----------DOF2
----->ARR11(3)   <---------GATA12      --------->AHL25(3)          ------>ZmHOX2a(2)    --------->ANAC55(2)
---AHL12(3)--------->GLK1(2)           --------->AHL12(1)      <---------YAB1<---------DAG2
 
atcatgttctaaagaatttgaatctgatcatataagtagagaataatttttaacaaaatttccattttgatcgattggaactttttgggttacttatttc  1888000
                                                                                       ------>NtERF2
                                                                                      <---------ATERF1(2)
                                                                                     <---------ANAC58
                                                                                <---------WOX13(2)
                                                                                --------->WOX13(2)
                                                                                <---------AHL12(2)
                                                                               <---------AHL20(2)
                                                                               <---------AHL25(1)
                                                                               <---------AHL25(2)
                                                                               <---------AHL25(3)
                                                                              <---------AHL20(2)
                                                                              <---------AHL20(1)
                                                                              --------->AHL20(2)
                                                                              --------->AHL12(3)
                                                                              <---------AHL25(1)
                                                                              --------->AHL25(3)
                                                               <---------MYB46(3)   --------->At4g35610
                                                               <------MYB83   <---------AHL25(3)
                                                               <------MYB46(1)<---------AHL12(1)
                                                        --------->ARR14(2)    <---------AHL12(3)
                                                        <---------ARR14(2)    <---------AHL25(2)
                                                        --------->GATA12      --------->AHL12(1)
                                                        <---------ARR11(2)    --------->AHL25(1)
                                                        --------->GLK1(2)    --------->AHL25(3)
             <---------ZAT6                        --------->ORA47(1)        --------->AHL12(2)
       ------>ZmHOX2a(2)                   <---------KAN1    <---------MYB52(1)--------->AHL25(2)  <
      <------ZmHOX2a(2)                   --------->GLK1(2)<-----------RAV1(1)--------->AHL25(2)   -
     --------->GATA12                ---------->DOF2   --------->WOX13(1)   <---------WOX13(2)     -
     --------->ARR11(3)        <---------ANAC46   --------->DEAR3(1)        --------->WOX13(2)------
     <---------ARR11(3)      <---------MYB46(3)  --------->DEAR3(2)   <----------DOF2<---------ANAC58
 <-----------GT1          <-----------RAV1(1)  <-----------GT1<---------AtMYB61<---------AHL12(3) --
 
gatgttacgatctctagtgttccaaacttctgtggtttgtaaaagaatttgaaccggccaatctgttggtttactttgtaattaatttgctggctgatgt  1888100
                               --------->WOX13(2)
                 ----------->GT1
                 <---------ANAC55(2)
                 --------->ANAC55(2)
      --------->DOF5.7(1)      <---------WOX13(2)
    ---------->DOF2       <------MYB83              <---------AHL20(3)
------>ZmHOX2a(1)<---------ANAC46      <---------MYB52(1)               <---------ZAT18
---------------AGL15      <------MYB46(1)           <---------AHL12(3)  <-------TEIL
-------------->AGL15      ----------->GT1           --------->AHL20(3)  --------->ZAT18           --
-------->TOE2(3)<---------TOE2(3)    <---------DEAR3(2)   <---------TOE2(3)             --------->LBD16
--->YAB5<---------GLK1(2)--------->MYB59       ----------->GT1  --------->At4g35610   <---------LBD16
--------------->AGL3  <---------WOX13(2)  <---------ANAC46<---------TOE1(3)       <---------KAN1  <-
 
ttcctaaaaaagattgtttgacgtaaatttggtaaattgtcggttttgtggagaaaaatataaggtttgctcaagtacacatcgactaaaccggagaaca  1888200
                                         <---------ICU4
                                         --------->YAB1
                                        <---------YAB5
                                        --------->ICU4
                                        <---------YAB1
                                       --------->AHL20(3)
                                       --------->AHL12(3)
                                       --------->WOX13(2)
                                       <---------AHL20(3)
                                       <---------AHL12(2)
                                       --------->AHL25(2)
                                       --------->AHL12(2)
                                      --------->YAB1
                                      <---------ICU4
                                      <---------AHL25(3)
                                      --------->YAB5
                                     --------->ICU4
                                     <---------ATHB51
                                     --------->AHL20(2)
                                     --------->AHL12(1)
                                     <---------AHL20(2)
                                     <---------AHL12(1)
                                     --------->AHL25(3)
                                     <---------AHL25(1)
                                     --------->AHL12(3)
                                     --------->AHL25(1)
                                   --------->AHL12(2)
                                   <---------AHL12(2)
                                  <---------AHL20(2)
                                 <---------AHL20(2)                    --------->TOE1(3)
                                 --------->AHL20(2)                  ------->TEIL
                                 --------->AHL20(3)                 ------>MYB83
                                 --------->AHL25(1)               <---------MYB59
                                 --------->AHL25(3)              --------------->AtSPL8
           ------------>CBF    --------->WOX13(2)            ------>ZmHOX2a(1)
          <-----------GT1      <---------WOX13(2)           --------->TOE2(3)
        --------->WOX13(2)    --------->WOX13(1)         <---------ARR14(2)         --------->HSFB2a(2)
        <---------WOX13(2)  ------------>CBF             --------->RVE1(2)      <---------TGA1a
 <---------DAG2            --------->ANAC58              --------->GATA12       --------->TGA1a
 <---------DOF5.7(1)       --------->ANAC58<---------YAB1<---------GATA12       --------->O2       -
 <----------DOF2    <---------KAN1<---------AHL25(3)     --------->ARR14(2)     <---------O2       -
------->ARR11(3)   --------->ARR11(2)<---------AHL12(3) ------>MYB46(1)--------->TOE2(3)          --
--------ARR11(3) ----------->GT1 <---------AHL25(1)     ------>MYB83------>MYB46(1) <---------HSFB2a(2)
 
agagcttttttagttacaatcggataaaccgagcaattaaataattatcactgtgaaccaaatcctaaaccgaaccttataagacgtctcgaatagatta  1888300
                                           <------ZmHOX2a(2)
                                          --------->ARR14(2)
                                          --------->ARR11(2)
                                          --------->GATA12
                                          <---------GATA12
                                    --------->ZAT2
                                    --------->At4g35610                                            <
           *TSS                     <---------At4g35610                                          ---
           <---------At4g35610      <---------ZAT2                                          <-------
           --------->At4g35610    <---------ZAT14                                <---------At4g35610
       --------->At5g28300        --------->ZAT14                         --------->DOF5.7(1)  <----
    <---------------------WRI1  --------->ANAC46   <---------KAN1       ---------->DOF2     <-------
  ----------->HVH21          <---------ZAT18    ------>NtERF2  --------->LBD16   --------->At4g35610
-------->TOE2(2)             --------->ZAT18   --------->DEAR3(1)     <---------ZAT6  <---------TOE1(3)
-------->TOE1(2)             <---------ZAT14<---------DEAR3(1)<---------LBD16   ------->TEIL<-------
--------->RAV1(2)            --------->ZAT14------>ZmHOX2a(2)<---------LBD16 <---------REM1(1)<-----
 
aacctgcgacggtaagctcaagagaggctgagtacactgagctgcgatcggcgactgtctcttgtccgggatagtgaaagatgaagctgaaggttgtgta  1888400
                                                                       --------->TGA1a
                                                                       <---------O2
                                                                       --------->ANAC46
                                                                       <---------TGA1a
                                                                       --------->bZIP60(1)
                                                                       --------->O2
                                                              =============HOX2a_HOX2a        <-----
                                                              <------ZmHOX2a(2)               <-----
                                                             <---------GLK1(2)           --------->WOX13(2)
                                                             --------->ARR11(2)      ------>NtERF2
    <---------GLK1(1)                                        <---------ARR11(2)     --------->DEAR3(1)
   --------->ARR11(3)                                        --------->GATA12       --------->RAP2.6(2)
   <---------ARR11(3)         ---------->DOF2                <---------GATA12       --------->RRTF1(2)
--------->SPL7(1)          ------>ZmHOX2a(2)                 <---------ARR14(2)     --------->RAP2.3(3)
---------MYB52(1)         <------ZmHOX2a(2)                --------->LBD16----------->GT1<---------WOX13(2)
------>YAB1              --------->GATA12                 --------->HSFB2a(2)       --------->RAP2.3(2)
--ANAC58                 <---------GATA12                 <---------HSFB2a(2)      --------->RAP2.3(1)
-----ARR11(2)            --------->ARR14(2)      --------->REM1(1)   <---------ALFIN1--------->LBD16
--ANAC58            <---------MYB52(1)        --------->TOE1(3)     ------>ZmHOX2a(1)<------NtERF2
--ANAC46 --------->YAB5  <---------ARR14(2)   --------->TOE2(3)  ------>ZmHOX2a(1) <---------LBD16
----CCA1(2)    --------->GATA12          <---------DOF5.7(1) --------->ARR14(2)  --------->ANAC46
 
tcgtaaggtctccgattacatctgttacgatctgaaagaaatcgtcttaccttcatcacttcccgatcctcctcacgtcgttaaacgccgcaaattgact  1888500
                                                                                                <---
                                                                                                ----
                                                                                                ----
                                                                                            --------
                                                                                     --------->LBD16
                                                                                     <---------LBD16
                                                                                   ------>ZmHOX2a(2)
                                                                                   =================
                                                                                  ==================
                                                                                 <-----------ARR10
                                                                                 <---------ARR14(3)
                                                                                 --------->GATA12
                                                                                 --------->GLK1(2)
                                                                                 <---------GATA12---
        <---------ARR11(2)                                                       --------->ARR14(3)
        --------->ARR11(2)                                                       <---------ARR11(2)
        <---------ARR14(2)                                                       --------->ARR11(2)
        --------->ARR14(2)                                     <--------P        --------->ARR11(3)
  ------->PIF5                                                <---------MYB52(1) <---------AGP1 <---
  <-------MYC3                                 <---------AHL20(2)                <---------RVE1(2)
  <-------PIF5                                <---------AHL20(2)                 <---------ARR14(2)
  ------->MYC2      <----------DOF2           --------->AHL25(3)--------->MYB52(2)<------ZmHOX2a(2)
  ------->MYC3    --------->At4g35610     <----------DOF2   --------->HSFB2a(2)  <---------ARR11(3)
  <-------MYC2    <---------At4g35610     <---------DOF5.7(1)--------->LBD16     --------->ARR14(2)
----ANAC58   --------->O2                <---------DOF5.7(1)<---------HSFB2a(2) <------ZmHOX2a(1)<--
----ANAC58  ------>ZmHOX2a(1)           ------>ZmHOX2a(1)  <---------LBD16     ----------->ARR10----
 
tggcacgagcgattcctcgtgagctttccttcactctctcttcctcttttttatttgaattttccggtagttttctattgagaggatctggggaatcaaa  1888600
         <------ZmHOX2a(1)
  <----------DOF2
------AHL25(2)                                 <XXXXXXXXXXXXXXXXXXXXMIR1887
----->AHL12(2)                     --------->ZAT18
----->AHL20(3)                     <---------ZAT14   <---------------AGL15
->YAB1  <----------ID1             --------->ZAT14   --------------->AGL15
================HOX2a_HOX2a     <---------ANAC46     <----------DOF2
================HOX2a_HOX2a     <---------ANAC58   --------->ZAT18
------>AHL12(1)               <-----------GT1 <---------ANAC58            <---------WOX13(2)
------AHL12(1)             <---------DOF5.7(1)<---------ANAC58            --------->WOX13(2) -------
-------AHL12(1)           <---------KAN1 <---------RVE1(2) <---------AHL20(2)   <---------ZAT6     -
----->AHL25(2)  ---------->DOF2 <---------ANAC58   <---------ZAT18    ---------->ID1        <-------
 
attttctttcaaggacaaacaaagttcgcattttttcgtgctctgattttcttgtgctctatttagtttttttgtccaatttagagtgaatgtgttctcg  1888700
          --------->YAB1
         <---------YAB5               --------->HSFB2a(2)
    <----------DOF2                   <---------HSFB2a(2)
 --------->ARR11(3)                --------->ARR14(2)                      --------->GLK1(2)
 <---------ARR11(3)                <---------ARR14(2)                      --------->ARR11(3)
<------MYB46(1)                    --------->GLK1(2)                       <---------ARR11(3)
<------MYB83--------->At4g35610    --------->GATA12                        --------->RVE1(2)
-->HSFB2a(2)<---------At4g35610    <---------GATA12                        <---------ARR14(2)
-------->MYB59                    <---------GLK1(2)                       <---------KAN1   ---------
----------AGL1          <---------At4g35610 --------->ALFIN1   ------->TEIL--------->ARR14(2)
 
attaggtctttaatcagcagatgtttgagatgatacagaatctggaagtgtgtgatttcatttatgtatattgtggaatatctgaaacacaaatgtgaca  1888800
<- Previous    Next ->

AGI:  At5g06240.1   
Description:  EMB2735 (EMBRYO DEFECTIVE 2735). similar to unknown protein [Oryza sativa (japonica cultivar-group)] (GB:AAS75234.1)
Range:  from: 1888312    to: 1889699    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version