AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                    --------->TGA1a
                                    <---------O2
                                    --------->ANAC58
                                    --------->ANAC58
                                    --------->O2
                                    <---------TGA1a                            <----------ID1
                                    --------->ANAC46                           <---------ETT(1)
                                    --------->bZIP60(2)                     --------->GLK1(2)
                                  <---------ALFIN1                         <---------GLK1(2)
                                --------->LBD16                           --------->YAB5
                                <-----------HVH21                         --------->KAN1
                <---------DOF5.7(1)------>NtERF2                          <---------HSFB2a(1)      -
               ------>ZmHOX2a(1)------>NtERF2                   ------>ZmHOX2a(2)                ---
          <------------------------ANAC81  <---------ARR11(3)  <------ZmHOX2a(2)               -----
      <---------GLK1(2)        --------->ANAC58    ====================HOX2a_HOX2a   --------->DOF5.7(1)
     <---------At4g35610       --------->ANAC58    ===================HOX2a_HOX2a  ---------->DOF2--
     <---------ZAT2            --------->ANAC46    <------ZmHOX2a(1)      --------->HSFB2a(1)  <----
 <---------ALFIN1             <---------LBD16  <---------MYB52(1)        --------->DOF5.7(1)<------NtERF2
 
tgctccacagcttctctcctcttctgttccttctccgccacgtcaatatcgttaggagagagagcgatctcttcgaaagattccgacaaagacgcgtcga  1764300
                                                                                                   -
                                                                                                 <--
                                                                                               <----
                                                                                            <-------
                                                                                            --------
                                                                                            <-------
                                                                                           <-------GAMYB
                                                                                           =========
                                                                                           ---------
                                                                                          --------->MYB55(2)
                                                                                          <---------DEAR3(2)
                                                                                          <---------ATERF1(1)
                                      ====================HOX2a_HOX2a                     <---------MYB46(3)
                                  ----------->HVH21                                      <---------DEAR3(1)
                                <---------ANAC46                                       <---------ERF1
                                <---------ANAC58                                   <---------O2<----
              ------->MYC2      <---------ANAC58                                   --------->O2<----
              <-------MYC2      <---------ANAC55(2)                               <---------HSFC1(2)
              ------->MYC3   --------->ARR11(2)                       ------>ZmHOX2a(2)<---------RAP2.3(1)
     ------>NtERF2           <---------ARR14(2)                     --------->ARR14(2) ------------>AtMYB77
 --------->ANAC46            <---------ARR11(2)                     <---------ARR11(2) <---------DEAR3(2)
 --------->ANAC58       ------------>AtMYB77                        <---------ARR14(2) ------>NtERF2
 --------->ANAC58      <---------ETT(2)                             <---------GATA12  <---------DEAR3(1)
<---------LBD16        --------->ETT(2)                             <---------RVE1(2) <---------At1g77200
-------->MYB52(1)    <-----------HVH21------>ZmHOX2a(2)             --------->GATA12<-----------HVH21
--->ZmHOX2a(2)<-------MYC3   --------->ARR14(2)     <---------TOE1(2)<------ZmHOX2a(2)<---------RAP2.3(3)
---->GATA12   <-------PIF5 <---------MYB46(3)      =========================HOX2a_HOX2a<---------ORA47(2)
--------->HVH21 --------->ZAT2  --------->ANAC55(2)------>ZmHOX2a(1)--------->ARR11(2)<---------DREB2C(2)
-----GATA12   ------->PIF5 <---------DEAR3(2)      ==========================HOX2a_HOX2a<------NtERF2
 
tctcacggagcctagcacgagctctgtcgacggtttcgtgatcgggtcttggtcctagggttcgaagaacagatcgggtctgagaaacgtcggcggttgc  1764400
                                                                                                  --
                                                                                                  <-
                                                                                                <---
                                                                                                <---
                                                                                               <----
                                                                                             <------
                                                                                         <---------KAN1
                                                                                        --------->ARR11(2)
                                                                                        <---------ARR14(2)
                                                                                        --------->GATA12
                                                                                        --------->ARR14(2)
                                                                                        <---------ARR11(2)
         <------NtERF2                                                             --------->ARR14(2)
 <---------YAB5                                                                    --------->ARR11(2)
-------->MYB52(2)                                                                  <---------ARR14(2)
-------MYB52(1)                         ----------->RAV1(2)                        <---------GATA12
-----ANAC46                      --------->ALFIN1                                  <---------ARR11(2)
--ARR11(2)                     <---------O2                                      --------->HSFC1(2)
->ARR11(2)              <---------KAN1  <---------At4g35610                      <---------HSFB2a(1)
--MYB52(1)            <------ZmHOX2a(1) --------->At4g35610                      <---------HSFC1(2)
=========================================MYC_MYB                        --------->YAB5  <---------GATA12
>ATERF1(1)      <---------KAN1 --------->O2                            <---------YAB1   <---------RVE1(2)
-----ANAC58 --------->ANAC58   <---------TGA1a                  <---------MYB46(3)<------ZmHOX2a(1)<
-----ANAC58 --------->ANAC58   --------->TGA1a     --------->RVE1(2)   --------->ICU4------>ZmHOX2a(2)
 
gttagtcatggaggcaagaacatcaggatgagccaagtgaggcatctgagtcactatctcgatagagtggtttgatgatgaagaaggatcggatttggat  1764500
                                   <------NtERF2
                                  <---------MYB46(3)
                                 <---------DEAR3(1)
                                 <---------ANAC46
                                 <---------DREB2C(2)
      --------->ANAC58      <---------KAN1                      --------->DOF5.7(1)
      --------->ANAC58     <---------GATA12              --------->ANAC46
    <---------ANAC58       <---------RVE1(2)             --------->ANAC58
    <---------ANAC58       <---------ARR11(2)        <------ZmHOX2a(2)
   <------NtERF2           <---------ARR14(2)       <---------ARR11(2)                       -------
  <---------MYB46(3)       --------->ARR14(2)       --------->ARR11(2)                       <------
------->ALFIN1             --------->ARR11(2)       --------->ARR14(2)                 <---------ZAT6
--------AtMYB61            --------->GATA12         <---------ARR14(2)                <---------TOE1(3)
---MYB83                  <------ZmHOX2a(1)         --------->RVE1(2)              -----------------
---MYB46(1)               ==================================HOX2a_HOX2a         --------->ARR11(3)
-----AtMYB61          --------->DOF5.7(1)           <---------GATA12            <---------ARR11(3)
---AtLEC2       --------->DOF5.7(1)--------->At5g28300   --------->ANAC58     --------->HSFB2a(1) <-
---------MYB46(3)   <------ZmHOX2a(1)               --------->GATA12          <---------HSFB2a(1)---
 
ggtggtggctcgacatcggaagaggaagaggatttggcggtgaatgaagggagacgatccaagacataagagagaacagggaagttcttagggttaagct  1764600
                                                                               --------->MYB52(2)
                                                                               <---------ANAC58
                                                                               <---------ANAC46
  <------NtERF2                                                                <---------ANAC58
 ------>NtERF2                                                                *TSS
--------->DEAR3(1)                                                            <-------TEIL
<---------ETT(2)                                          >>>>>>>>>TBF1<---------KAN1            ---
-->At4g35610                                        >>>>>>>>>TBF1      --------->ATHB12         ----
---At4g35610  <---------ZAT2  --------->ATHB12   >>>>>>>>>TBF1        --------->ICU4            <---
---->WRI1     --------->At4g35610          <---------TOE2(3) >>>>>>>>>TBF1 <---------MYB46(3)   <---
--------ATERF1(1)          --------->CCA1(2) <------ZmHOX2a(1)        <---------YAB1           -----
------>DEAR3(1) <----------DOF2      <---------RVE1(2) >>>>>>>>>TBF1  <---------ATHB51       ------>ZmHOX2a(1)
 
ccgtcgccattgttgggagcttgatggaagagacgattgggagattgaggaagaagaagaagaagaagaagcgattattggttcgtgtctcatgtccttc  1764700
                                                  <-------MYC2
                                                  <-------MYC3
                                                  <-------MYC4
                                                  ------->MYC4
                                                  ------->PIF5
                                                  <-------PIF5
                                                  ------->MYC3
                                                  ------->MYC2
                                                 --------->ANAC46
                                                 --------->ANAC55(2)
                                                 <---------TGA1a
                                                 <---------O2
                                                 --------->O2
                                           <---------WOX13(2)
                                           --------->WOX13(2)
                                          <---------AHL12(2)
                                          --------->AHL12(2)
                                      --------->TOE1(3)
                                      <-------GAMYB
                                      --------->TOE2(3)
                                    <------ZmHOX2a(2)
                                   --------->ARR11(3)
           XXXXXXXXXXXXXXXXXXXX>MIR859=====================MYC_MYB
          --------->RVE1(2)        <---------ARR11(3)
         <---------KAN1        ---------->DOF2   --------->TGA1a              ------------>CBF
------>LBD16             ---------->DOF2 --------->AHL20(2)               <---------O2
----->ANAC55(2)          ==================================bZIP_DOF       --------->O2
------ANAC58         --------->ANAC58------>ZmHOX2a(2)               --------->ANAC58             --
------ANAC58  <------------CBF ============================bZIP_DOF  --------->ANAC46        -------
---------->AtSPL3    --------->ANAC58----------->GT1                 --------->ANAC58     ------>ZmHOX2a(1)
 
cgtactattagcatctctattgccaagtcaaagtcaaagatcgttaaattacacgtggttttgtattaatacaagacaagtgtcaatgttatcctacaaa  1764800
                                              --------------->AGL15
                                              <---------------AGL15
                                           <-----------GT1
                                        <---------AHL12(2)
                                       <---------AHL20(3)
                                       <---------AHL25(2)
                                       --------->AHL20(3)
                                       <---------AHL12(2)
                                       --------->AHL25(2)
                                       <---------AHL12(3)
                                      <---------AHL12(1)
                                      --------->YAB1
                                      <---------AHL20(1)
                                      --------->AHL20(2)             <---------TOE1(3)
                                      --------->AHL12(3)             <---------TOE2(3)
                                      <---------AHL20(2)         <---------AHL12(2)
                                      --------->AHL12(1)         <---------WOX13(2)
                                      --------->AHL25(2)         --------->WOX13(2)
                                      <--------ATHB1            <---------AHL25(3)
                                      <---------AHL25(2)       --------->AHL12(1)
                                      <---------AHL25(3)       <---------AHL12(1)
                                      --------->AHL25(1)       <---------AHL20(2)
                                      <---------ICU4           --------->AHL25(3)
                                      <---------AHL25(1)       <---------AHL12(3)
                                     --------->ICU4            --------->AHL12(3)
                                     <---------YAB1            --------->AHL20(2)
        --------->KAN1               --------->AHL25(3)        --------->AHL20(1)
        --------->YAB5              <---------AHL12(3)         <---------AHL25(3)
       <---------YAB5               <---------AHL25(2)         <---------AHL25(2)
       <---------ATHB12             --------->AHL25(2)         --------->AHL25(2)
    --------->AHL12(1)              --------->AHL20(3)         <---------AHL25(1)
    <---------AHL12(1)              --------->AHL12(3)         --------->AHL25(1)
   <---------AHL25(1)               <---------AHL20(3)        --------->AHL25(1)
   --------->AHL25(1)               <---------AHL12(2)        --------->AHL25(3)
   --------->AHL20(3)               --------->AHL12(2)        --------->AHL25(2)
   <---------AHL20(3)              <---------AHL25(3)         --------->AHL12(3)
--------->GT1                      --------->YAB1             --------->AHL20(2)
--->DOF2<---------ICU4            --------->AHL20(2)          <---------AHL25(2)   <---------RVE1(2)
 
gaagaaaaaaatcattctaaaaacacttcttacacaaataataattttacacttagtagaaacaaattaattaaggttttagaatagataagataaccaa  1764900
                                          <---------YAB1
                                         <---------AHL12(2)
                                         <---------AHL12(3)
                                         --------->AHL12(3)
                                         --------->AHL12(2)
                                         <---------AHL25(2)
                                         --------->AHL25(2)
                                        <---------AHL25(3)
                                        <---------AHL25(2)
                                        <---------AHL25(1)
                                        --------->AHL25(1)
                                        --------->AHL12(1)
                                        <---------AHL12(3)
                                        --------->AHL25(2)
                                        <---------AHL12(1)                        <-----------------AGL3
                    <---------TOE2(3)   --------->AHL12(2)                        ----------------->AGL3
                    <---------TOE1(3)  --------->AHL12(1)               >>>>>>>>>ARR2
                <---------WOX13(2)     <---------AHL12(1)               >>>>>>>>>ARR1
                --------->WOX13(2)     --------->AHL25(3)             <---------YAB1
              <---------AHL20(2) ----------->GT1                      <---------TOE1(3)
              --------->AHL20(2)--------->DAG2                        <---------TOE2(3)     --------
            <----------DOF2     --------->DOF5.7(1)        ---------->ID1         ----------------->AGL1
            --------->TOE2(3)  ---------->DOF2  ---------->ID1<---------YAB5    ------>NtERF2
 
gaagtttagagaaaactttaattaaggtttttgaaaaagtgaataatttttgttgttattttgtcttcattttaagattgtgaggcccaatattggtgac  1765000
                        ------>ZmHOX2a(2)
                      <---------ARR11(3)
                      --------->ARR11(3)            --------->HSFB2a(2)
                     --------->YAB1                 <---------HSFB2a(2)
                    <---------KAN1               <----------DOF2    --------->DOF5.7(1)
                    <---------YAB5            <---------YAB1        --------->DAG2
                   <---------KAN4(2)        --------->KAN1         ---------->DOF2
            <---------ANAC58               <---------YAB1          --------->DOF5.7(1)
--->HVH21   <---------ANAC58             ----------->GT1  ----------->GT1                         --
 
acaaatgttttatgggcttgagaatgatcttagggaaaactatattgttattcttttggaaatgaaaaaaaaaagctcatttttgagactatgcaatgga  1765100
                          --------->YAB1
                         <---------YAB1
                         --------->ICU4
                        <---------AHL12(3)
                        <---------AHL12(2)                                            --------->ICU4
                        <---------AHL20(3)                                            <---------YAB1
                        <---------AHL25(2)                                          --------->YAB5
                        --------->AHL25(2)                                          <---------ICU4
                        --------->AHL20(3)                                          --------->YAB1
                       <---------ICU4                                              --------->ICU4
                       --------->YAB1                                              <---------YAB1
                      --------->ICU4                                             --------->YAB1
                      <---------YAB1                                            <-------TEIL
                     --------->AHL20(3)                                      --------->YAB5
                     <---------AHL20(3)                                     <---------YAB1
                     --------->AHL25(2)                                     <---------YAB5
                    --------->YAB1                                          --------->ICU4
                   <---------YAB1          --------->HSFB2a(2)            --------->YAB1
                 --------->YAB5      <-----------GT1  <---------YAB5      --------->YAB5
                 --------->YAB1 --------->AHL20(2) <-----------GT1        <---------ICU4
         <---------RVE1(2)<---------ICU4<----------DOF2                  --------->ICU4
------->GLK1(2) <---------YAB1----------->GT1   <---------KAN1           <---------YAB1--------->YAB5
 
gactctgttttcgatatgtatgataataataataagttaataacttttggaattttactgatttttctgtaatctcatgatgattcatgatgatgaagac  1765200
<- Previous    Next ->

AGI:  At5g05850.1   
Description:  leucine-rich repeat family protein. similar to leucine-rich repeat family protein [Arabidopsis thaliana] (TAIR:AT3G11330.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO64249.1); contains InterPro domain Leucine-rich repeat; (InterPro:IPR001611); contains InterPro domain Leucine-rich repeat, typical subtype (InterPro:IPR003591)
Range:  from: 1762406    to: 1764679    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version