AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                         --------->ANAC58
                                                                 <-------GAMYB
                                                                 <---------WOX13(2)
                                                                <---------MYB46(3)
                                                                --------->MYB52(2)
                                                                --------->MYB55(2)
                                                                --------->MYB46(2)
                                 <---------------AGL15          --------->MYB111(2)
                       <---------MYB52(1)                       --------->MYB111(1)
                    <---------YAB5                  ----------->GT1      --------->ANAC58
                   --------->GLK1(2)    <---------TOE2(3)    ------------>MYB.PH3(2)
                  <---------GLK1(2) --------->TOE2(3)----------->GT1   ---------->DOF2
                 --------->KAN1  --------------->AGL15  <---------AHL20(2)
 
agaagttgtcttcttgagagagaatcgttgagttttctacattaagaaacagagcatgttaaaatgttagttgggaaagaaacagagaagattgctctgt  1207000
                    --------->YAB1
                   <---------YAB1
                 --------->YAB1
                <---------YAB1
              <---------ICU4
              <--------HAHB4
              --------->YAB5
              --------->YAB1
             <---------YAB1
             <---------YAB5                                                             --------->DOF5.7(1)
           <---------ICU4                                                 <---------ANAC58
          --------->ICU4                          <----------DOF2         <---------ANAC58
          <---------YAB1  --------->MYB52(1)      <---------DAG2          <---------ANAC55(2)
       <---------YAB1    <---------KAN1     <-------TEIL   --------->AHL12(1)         ---------->DOF2
       <---------YAB5  --------->YAB1      --------->CCA1(2)             <-----------------------TaNAC69(2)
 <---------RVE1(2)--------->AHL20(3)    <---------YAB5     <---------AHL12(1)     <---------KAN1
 
ttctgatattgtcattatcattataagaataacagaggttttaaagattcaaacttttttgaaattttagttggattacttgagaatgagaaagacccac  1207100
                                                        ----------->GT1
                                                       --------->DAG2
                                         <---------AHL20(2)
                                         --------->AHL25(1)
                                         --------->AHL20(2)
                                         <---------AHL20(3)
                                         <---------AHL25(3)
                                         <---------AHL25(1)
                        --------->TOE1(3)--------->AHL20(1)                                       <-
              --------->YAB5             <---------AHL25(2)                                       <-
  --------->DAG2        --------->TOE2(3)--------->AHL25(2)  <-----------GT1               ---------
 ---------->DOF2------->TEIL        --------->AHL20(2)---------->DOF2      --------->YAB1<---------LBD16
 
aagataaagcatgaaaatgaatcaaacccttaaatgaaatcaaataaaatgtaagagaaaagttatacctttgaacattaagaacaacatgttcagggaa  1207200
        --------->ALFIN1
      --------->ALFIN1
      <---------ANAC58
      <---------ANAC58
      <---------ANAC46
    <------MYB46(1)
    <------MYB83
   <---------AtMYB61
  <--------P                             <-------TEIL
 <-------GAMYB                          <--------P
<-----------RAV1(1)                  <---------TOE2(3)
--------->ALFIN1                 --------->At4g35610
--------ANAC58     --------->ATHB12  <---------TOE1(3)
--------ANAC58    --------->DOF5.7(1)<---------AtMYB61
>LBD16<-----------RAV1(1)     --------->KAN1 --------->YAB5                    ----------->GT1
 
tgggtgttggtgtgggagagaaagattgaagatagatgctgaggttgatgatgctcttccatggtgagagagagaaaccaagaggcaaaaccagataatg  1207300
                                    --------->YAB1
                              ------>ZmHOX2a(1)
                            =====================================HOX2a_HOX2a
                            ------>ZmHOX2a(2)
                           <------ZmHOX2a(2)
                           =============HOX2a_HOX2a
                          <---------GATA12                      <---------ARR11(3)
        <---------MYB46(3)<---------RVE1(2)                     --------->ARR11(3)
        <------MYB46(1)   --------->ARR14(2)                   <---------CCA1(2)
        <------MYB83      --------->GATA12                    <---------AHL20(2)
       <---------TOE2(2)  <---------ARR14(2)        --------->ARR11(3)           --------->At4g35610
      <---------MYB52(1)  ------->TEIL              <---------ARR11(3)           <---------At4g35610
     <-------MYC2         --------->ARR11(2)     --------->AHL20(2)      ---------->DOF2
     <-------MYC3         <---------ARR11(2)  --------->YAB5 --------->YAB1      --------->ZAT2
     ------->MYC3      <---------TOE2(3)    ------>NtERF2 ------>ZmHOX2a(1)--------->DOF5.7(1)
     ------->MYC2  --------->ARR11(3)     --------->MYB46(3) --------->AHL20(2) ----------->RAV1(1)
   ------->TEIL   --------->YAB5 ------>ZmHOX2a(1) <---------CCA1(2)  <---------YAB1
 
caaatgcacgttggtttttgaagattatggatcctcctctcatgagccaccattatatctcctattatatcttatgaaaagaccagcagaattagaaact  1207400
                                                                                    <---------ANAC58
                                                                                    <---------ANAC58
                                                                            <---------ANAC58
                                                                            <---------ANAC46
                                                                     <---------AHL20(1)
                                                                     --------->AHL12(3)
                                                                     <---------AHL25(1)
                                                                     --------->AHL25(1)
                                                                     --------->AHL25(2)
                                                                     <---------AHL25(2)
                                                                     <---------AHL25(3)
                                                                     --------->AHL25(3)
                                                                     <---------AHL12(3)
                                                 --------->AHL20(2)  <---------AHL20(2)
                                               --------->WOX13(2)    --------->AHL20(1)
                                              --------->YAB1         --------->AHL20(2)
                                             <---------AHL20(2)     <---------AHL12(3)
                                            --------->AHL20(2)      --------->AHL12(2)
               <----------DOF2    <------------CBF                  <---------AHL25(2)            <-
    ------>ZmHOX2a(1)             <---------WOX13(2)                --------->AHL25(1)            --
   --------->TOE2(3)     <------------CBF  --------->AHL12(2)       --------->AHL20(2)    ------>ZmHOX2a(1)
   --------->TOE1(3)<---------------ANT  <-----------TBP            --------->AHL25(3)   -----------
<---------ARR11(3)  <---------LBD16   ----------->GT1        ---------->DOF2<---------ANAC58      --
 
caagttccttaaatatgggtttatggggaattgtgcaaattgggttatataataaactagggccaaaagaattttatttgtgtgtttgccttcctacata  1207500
                                                                                       ------>ZmHOX2a(1)
                                                                                      --------->TOE2(3)
                                                                                   --------->ARR14(2)
                                                                                   <---------ARR11(2)
                                                                        --------->DOF5.7(1)
                                                                       --------->DOF5.7(1)--------->DAG2
                                                                      --------->DOF5.7(1)---------->DOF2
                                            <---------WOX13(2)     ----------->HVH21  --------->TOE1(3)
--------ARR11(3)                       ----------->GT1         --------->ALFIN1    <---------ARR14(2)
------->RVE1(2)                      ---------->DOF2   --------->DOF5.7(1) <-----------HVH21       -
---------->WRI1               ------------------------>ANAC81  <---------KAN1      --------->GLK1(2)
------->ARR11(3)              --------->ALFIN1       ---------->DOF2 ---------->DOF2 --------->YAB5<
 
gtatctctctctaatctctctagtttgtttcaagtggaagaaaagaaaattagagagaaagagagagtgtgtgaaaggggtcagagaatccttaaagtgc  1207600
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                                               -----
                                                                                            <-------
                                                                                            <-------
                                                                                            <-------
                                                                                            --------
                                                                                            <-------
                                                                                            <-------
                                                                                           ---------
                                                                                     --------->ANAC58
                               <---------YAB1                                  --------->YAB1  <----
                            --------->GATA12                           <-----------GT1    <---------TGA2(2)
                            <---------GATA12                    <---------ANAC58     --------->ANAC46
                         ------------>CBF                       <---------ANAC58     --------->ANAC58
                    <----------DOF2                          <---------ZAT14  <---------ATHB12 -----
 --------->YAB1 <---------ALFIN1                             --------->ZAT14--------->WOX13(1)------
-------->WOX13(2)  <---------DAG2<---------GLK1(2)  <---------KAN1   --------->WOX13(2)  -----------
---------WOX13(2)  <---------DOF5.7(1)   <----------DOF2   --------->WOX13(2) <---------YAB5<-------
 
ttaatcaaaactatttctcccacctttctccaatctgattcttacttttgtaagagtgactcagtttacttgaattacccaatcatccacgtatgacgta  1207700
---->RVE1(2)
---->ARR11(2)
-----ARR14(2)
---->ARR14(2)
--ANAC58
--ANAC46                                                               <---------TOE2(3)
--ANAC55(2)                                                          <---------ATHB12
->ANAC55(2)                                                  <---------KAN1
--ANAC58                             <---------DOF5.7(1) --------->LBD16
--ANAC55(1)                         <----------DOF2     --------->ANAC46
-->STF1                            <---------DOF5.7(1)  --------->ANAC55(2)
-----ARR11(2)            <---------GATA12               <---------ANAC55(2)                  <------
-->TEIL                  <---------RVE1(2)   <-----------HVH21    --------->YAB5 <---------ANAC58
--->KAN1       <---------DOF5.7(1) <---------DAG2      <---------LBD16--------->YAB1        --------
>HVH21         <---------DAG2 --------->At4g35610   <-----------HVH21<---------ATHB51    <---------YAB5
--bZIP60(2)    <----------DOF2<---------At4g35610  --------->YAB1<---------ATHB12<---------ANAC58---
 
tccctctctctaaaacaacttttctatggatttagcagcctttttatatgtcactgatcacgggataaatcaataatgtagtttgcgttataaacatgca  1207800
                                                                    --------->ANAC58          ------
                                         --------->TOE1(3)     --------->At4g35610           -------
                                         --------->TOE2(3)     <---------At4g35610           -------
-TEIL                    --------->RVE1(2)          --------->KAN1  --------->ANAC58       <--------
->AtLEC2             <-------TEIL  <---------ICU4  --------->ARR14(2)        <---------MYB52(1)    <
------>RVE1(2)      --------->AtLEC2   -------->P  <---------ARR14(2)  <---------GLK1(1)   ---------
 
tataaaacttagaccaaaaaaacatgcatataaaacaatacttaccttgacgaaaatactcgatgcagcgcaagaattctcttagtttttgaaagattta  1207900
<- Previous    Next ->

AGI:  At5g04310.1   
Description:  pectate lyase family protein. similar to PMR6 (POWDERY MILDEW RESISTANT 6), lyase/ pectate lyase [Arabidopsis thaliana] (TAIR:AT3G54920.1); similar to pectate lyase-like protein [Brassica napus] (GB:AAQ87025.1); contains InterPro domain Pectin lyase fold (InterPro:IPR012334); contains InterPro domain Pectate lyase/Amb allergen (InterPro:IPR002022); contains InterPro domain Pectin lyase fold/virulence factor (InterPro:IPR011050)
Range:  from: 1203204    to: 1207353    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version