AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
         ------->MYC3                                                      --------->AHL20(3)
         <-------MYC3                                                      --------->AHL20(2)
      <---------TGA1a                                                      <---------AHL20(3)
      <---------O2                                                         <---------AHL20(1)
      --------->TGA1a                                                      --------->AHL25(1)
      --------->O2                                                         --------->AHL20(1)
  <-----------HVH21                                                        <---------AHL25(3)
------ICU4                                                                 --------->AHL25(3)
----->ATHB51                                                               <---------AHL25(2)
----->YAB1                                                                 <---------AHL25(1)
-----ATHB51                                                                --------->AHL25(2)
-----ATHB12                                                                <---------AHL20(2)
---->ICU4<-------MYC2        <-----------GT1                               --------->AHL12(1)
-->WOX13(1)                 --------->KAN1                           --------->YAB1
------->AGL15               --------->YAB1                       <---------AHL20(2)
--------AGL15              <---------ATHB12                     <---------AHL20(3)
---------AGL2              --------->ICU4                       --------->AHL20(3)
-------->AGL1             --------->WOX13(2)                    <---------AHL12(3)
---------AGL3          <---------ZAT14                   <-----------GT1--------->YAB1
-------->AGL3  --------->RVE1(2) ------>ZmHOX2a(1)       --------->MYB52(1)<---------AHL12(1)
---------AGL1  <---------GATA12 --------->TOE2(3)--------->RVE1(2)   ----------->GT1               -
->AtSPL8 ------->MYC2  --------->ZAT14           <---------GATA12<---------AHL25(3)            -----
--AtSPL8 ------->MYC4  <---------ZAT18   --------->YAB1<---------MYB52(2) --------->AHL25(3) -------
 
tatggagtcacatgtgcaaatcgcagtgcaattatcctcataagtcataacaaatccaaataacgaaatttatagtaataaattctacagagaaccaaaa  957300
                           <---------AHL20(2)
                         <---------WOX13(2)
                         <---------AHL12(2)
                       <---------AHL25(1)
                       <---------AHL25(3)
                       --------->AHL20(2)
                       <---------ICU4
                       --------->ATHB51
                       --------->AHL12(3)
                       <---------AHL12(3)
                       --------->AHL25(1)
                       <---------AHL20(2)
                       <---------AHL12(1)
                       --------->AHL12(1)
                      --------->AHL25(3)
                      <---------YAB1
                      <---------YAB5
                      --------->ICU4
                     <---------AHL20(3)
                     <---------AHL12(3)
                     <---------AHL12(2)
                     --------->AHL12(2)
                     <---------WOX13(2)
                     --------->AHL20(3)
                    --------->YAB1
                    --------->YAB5                 <---------RVE1(2)
                    <--------HAHB4                 --------->ARR11(3)
                    <---------ICU4                 <---------GLK1(2)
          --------->ARR11(3)               --------->TOE2(3)
          <---------ARR11(3)   <-----------GT1     <---------GATA12                                -
--------->ANAC58   --------->ICU4        <---------ARR11(3)                           <---------KAN1
--------->ANAC58   <---------ATHB51      <---------GATA12                      --------->DOF5.7(1) -
-------------->AtSPL8<---------AHL25(2)  <-----------ARR10               --------->RVE1(2)         -
---->DOF5.7(1)    <---------MYB52(1)     --------->RVE1(2)    ---------->DOF2---------->DOF2      <-
--->DOF2 <---------CCA1(2) --------->AHL20(2)      --------->GATA12      <---------GATA12 ------>NtERF2
 
gacaagtactatatatcttccgataattatttaaaaaccctacaaatcttattagattttgaacataaaaccccaaaatccaaagacgagtgcctccatc  957400
                                                                                      <---------WOX13(2)
                                                                                    --------->ICU4
                                                                                   <---------RVE1(2)
                                                                                   --------->ARR11(3)
                                                                             <---------RVE1(2)
                                                                       <---------AHL12(1)
                                                                       --------->AHL12(1)
                                                                       <---------AHL25(1)
                                                                       <---------AHL25(3)
                                                                       --------->ATHB51
                                                                       --------->ATHB12<---------YAB1
                                                                       --------->AHL20(2)
                                                                       <---------AHL20(2)
                                                                      --------->AHL12(1)
                                                                      --------->AHL25(1)
                                                                      <---------AHL20(2)
                                                                      <---------AHL20(1)
                                                                      <---------AHL12(1)
                                                                      --------->AHL20(2)
                                                           <-------MYC3--------->AHL25(1)
                                   --------->YAB5    --------->ZAT14  --------->AHL25(3)
------->ATHB1                     <---------YAB1     <---------ZAT18  --------->AHL25(2)
-------->YAB1            ------>MYB46(1)      --------->ANAC46 ----------->GT1   <---------ZAT6
-------->ATHB51          ------>MYB83      <-------TEIL    ------->MYC3<---------AHL12(3)
--------YAB1  <----------ID1   <---------RVE1(2)    --------->AtLEC2  <---------AHL25(2)--------->YAB1
 
tattattgtctctaagtgagacaaaacctacattgatatgaatacatacacatcaatgcacacatgtagtcaaattatttgatagagataatgaaaactg  957500
                                                             --------->WOX13(2)
                                                             <---------WOX13(2)
                                                             <---------AHL20(3)
                                                             --------->AHL20(3)
                                                            --------->YAB5
                                                           <---------YAB1
                                                      --------->RVE1(2)
                                                      --------->ARR11(3)
                                              <---------GATA12--------->ICU4
                                              --------->GATA12<---------YAB1
                                              <---------AGP1<--------HAHB4
                                              --------->AGP1--------->YAB1
                                              <---------ARR11(3)
                                              --------->RVE1(2)--------->AHL20(2)
                                              <---------ARR14(2)
                                              --------->ARR11(3)
                                              --------->ARR14(2)        <---------ARR11(3)
                                             --------->RVE1(1)<---------YAB5
                                            --------->DOF5.7(1)--------->YAB1
                               --------->RVE1(2)------>ZmHOX2a(2)       --------->ARR11(3)
                               <---------GATA12<------ZmHOX2a(2)    <---------YAB5
                               <---------ARR11(3)     <---------ARR11(3)--------->RVE1(2)
       <-----------RAV1(1)     --------->ARR11(3)    <---------CCA1(2) <---------CCA1(2)
      <-------MYC3            <---------GLK1(2)--------->CCA1(2)<---------AHL12(2)
      ------->MYC3    <-------TEIL        ---------->DOF2  <---------AHL20(2)     <---------CCA1(2)
 
agctagacacatgttgcaaaacacatacatacaaaatctcatacaaaaagatctgtatatctataattataaacatatctctctcatctctcactctctc  957600
                                                                                               <----
                                                                                               <----
                                                                                               -----
                                                                                               -----
                                                                                          <---------REM1(2)
                                                                                     --------->ZAT18
                                                                              <---------DOF5.7(1)---
                                                                             <----------DOF2   <----
                                                                             <---------DAG2    -----
                                                                             <---------DOF5.7(1)<---
                                                                <---------ANAC58     --------->WRKY38(1)
                 --------->YAB1                                 <---------ANAC58     <---------ZAT18
         --------->KAN1      <---------ZAT6             --------->ARR11(2)  <---------DAG2<---------ZAT14
       <---------ALFIN1      ----------->GT1            <---------ARR11(2)  <---------DOF5.7(1)<----
     <---------ALFIN1     --------->DAG2          <---------CCA1(2) --------->KAN1<---------ANAC46
   ----------->RAV1(1)   ---------->DOF2     <---------PCF2    <---------At4g35610<---------ANAC58
   <---------ALFIN1   <---------KAN1         <---------PCF5    --------->At4g35610<---------ANAC58
 
tctcgcccacacacattcaagaagaatataaagtgttattaagtcatgggaccatatcgtttctgtagcttacattcgacctttttcgtggactacacga  957700
                                                                                                 ---
                                                            <---------DOF5.7(1)              <------
                                                           <----------DOF2           <----------DOF2
-----ARR11(2)                                              --------------->AGL15    --------->TOE2(3)
-----ARR11(3)                                              <---------------AGL15    --------->TOE1(3)
---->RVE1(2)                                              <---------DOF5.7(1)       <---------DOF5.7(1)
---->GATA12                                               <-----------------AGL3 <-----------GT1<---
--->ZmHOX2a(2)                                        <-----------GT1       ----------->GT1 <-------
-----GATA12                     --------->YAB1   <---------DOF5.7(1)     ---------->DOF2   <--------
---->ARR14(2)            --------->ZAT6         <----------DOF2         <---------AHL20(2) <--------
---ZmHOX2a(2)     <----------DOF2         *TSS <---------DOF5.7(1)     <---------AHL20(2) <---------DAG2
-----ARR14(2)    <---------DOF5.7(1)---------->DOF2 <-----------GT1    --------->AHL20(2) <---------DOF5.7(1)
 
tctgtctctctctcactctctctttctatctctaaaaataaaagcttcagtcttttttctctctttttttggaattaaaaggtttaacctttaccttttt  957800
                                                                                                   <
                                                                                                   -
                                                                             <---------ZAT14       <
                                                                             --------->ZAT14    <---
                                                                             --------->SPL7(1) -----
                                                                        ------>ZmHOX2a(1)      <----
                                          <---------GATA12          --------->ARR14(2)         -----
                               --------->At4g35610                --------->At4g35610     <---------At4g35610
                    ------>ZmHOX2a(2)  <---------AHL25(1)      <------ZmHOX2a(2)          --------->ZAT2
                  <---------ARR11(3)   <---------AHL12(2)      ================HOX2a_HOX2a--------->GLK1(1)
                  <---------RVE1(2)    <---------AHL20(2)     --------->RVE1(2)           <---------GLK1(1)
               <---------WOX13(1)      --------->AHL12(3)     <---------ARR11(3)       --------->LBD16
  --------->ZAT14 --------->ARR11(3)   <---------AHL12(3)     <---------GATA12       <---------LBD16
------->ID1   <---------WOX13(2)       --------->AHL25(1)     --------->ARR14(2)    --------->MYB52(1)
---DOF5.7(1)  --------->AHL12(2)       --------->AHL20(2)     --------->ARR11(3)  <---------ZAT14  -
--------GT1   --------->WOX13(2)      --------->AHL12(2) <------ZmHOX2a(2) <---------SPL7(1) <------
--DOF5.7(1) <---------ATHB51   <---------At4g35610       ======================HOX2a_HOX2a--------->At4g35610
--DOF2 --------->RVE1(2) <---------DOF5.7(1)      --------->DOF5.7(1)  --------->TOE2(3)  <---------ZAT2
-DOF5.7(1)  <---------YAB1<----------DOF2 --------->GATA12    --------->GATA12    --------->ZAT14  <
 
ttcccttcactatcgataattgatcttctctttcggctgaatataaatctgaaaaaatggatcaagatcagcatcctcagtacggtataccggagctccg  957900
                                                                                                   <
                                                                                                   -
                                                                                                   -
                                                                                                   -
                                                                                                  --
                                                                                                  <-
                                                                                                 ---
           <---------DEAR3(1)                                                                    <--
           --------->ALFIN1                                                                     <---
          <---------LBD16                                                                       ----
      ---------->DOF2                                                                           ----
    <---------YAB1                                                                              <---
------NtERF2                                                                                   <----
-------->ZAT2                                                                               <-------
---------ZAT2    <---------------AtSPL3                                                     <-------
------MYB52(1)  <------ZmHOX2a(1)                                                           --------
---->LBD16<-----------------------TaNAC69(2)                                                --------
-------HVH21 <------NtERF2                                                                 ---------
->NtERF2--------->DAG2            <---------ALFIN1                                       --------->LBD16
-------->At4g35610     --------->YAB5                                                   <---------DEAR3(1)
---LBD16--------->DOF5.7(1)    --------->REM1(1)                              <-----------GT1  -----
---------At4g35610  <------ZmHOX2a(1)--------->DEAR3(1)          --------->GLK1(1)     <---------LBD16
 
gcagctcatgaaaggcggaggaaggacgactactacaacaccgtctacttcttctcattttccctctgatttcttcggttttaaccttgctccggtgcag  958000
     <---------ALFIN1
   <---------ALFIN1
   --------->DEAR3(1)
   --------->AtMYB61
   ----------->RAV1(1)
 --------->ABI4(1)
 ------>NtERF2
 <-----------HVH21
--------->DEAR3(1)
--------->RAP2.6(2)
--------->DREB2C(2)
--------->DEAR4(1)                                           <-------TEIL
--------->ANAC58                                      <-------MYC2
--------->ANAC46                                      ------->MYC2
------->GAMYB                                        >>>>>>>>>>HY5
--------->ANAC58                                     <---------PIF3(3)
------NtERF2                                         <---------bZIP60(2)
-------->ATERF1(1)                                   <<<<<<<<<<HY5
-------->MYB46(3)                                    --------->PIF3(3)
-------->RAP2.3(1)                                   --------->bZIP60(2)
---->NtERF2                                          <---------O2
--------ATERF1(1)                                    --------->TGA1a
------>DEAR3(1)                                      <---------TGA1a
-------ALFIN1                                    <-----------------PIF3(1)
------MYB55(2)                                   <----------------PIF3(2)
----->MYB46(3)                                <---------ANAC58                  <-------TEIL
----->ATERF1(1)                               <---------ANAC58                 --------->ARR14(2)
------ABI4(2)                        --------->CCA1(2)<-------PIF5             <---------ARR14(2)
-----At4g35610       --------->ZAT18<---------ARR14(2)------->MYC3       --------->ALFIN1
--ZAT14              <---------ZAT18--------->ARR11(1)------->MYC4     <---------ANAC46
--ZAT18              <---------ZAT14<---------RVE1(2)--------->O2      <---------ANAC58
->ABI4(2)            --------->ZAT14--------->ARR14(2)<-------MYC4     <---------ANAC58
->ZAT14            --------->At4g35610       --------->MYB52(2)       <---------MYB46(3)          --
>ALFIN1          <---------ICU4     --------->ARR11(3)------->PIF5    --------->MYB55(2)    --------
->NtERF2--------->DEAR3(1)          <---------ARR11(3)<-------MYC3 <---------RVE1(2)   --------->MYB46(3)
 
ccaccgccacaccgtcttcatcagttcactactgatcaagatatgggtttcttgccacgtggcatacatggattgggtggaggttcttcaacggctggaa  958100
                                                                          --------->At4g35610
                                                                          <---------At4g35610
                                                                  <---------ARR11(2)
                                                                  <---------ARR14(2)
                                                                  --------->ARR11(2)
                                      <------MYB46(1)           <---------MYB46(3)                 <
                                      <------MYB83           --------->MYB55(2)                    <
                                     --------->MYB59         <---------MYB46(3)                    -
                                 --------->ALFIN1           <---------DEAR3(1)                     -
                           <---------ANAC46              <---------DREB2C(2)                      <-
                           --------->ALFIN1              <---------DEAR3(1)                   <-----
                         <---------MYB46(3)         <---------ANAC58      <------NtERF2----------->HVH21
                        <-----------RAV1(1)    <------MYB83 --------->ALFIN1           <---------ARR14(2)
  --------->At5g28300   <---------AtMYB61      <------MYB46(1) <---------AtMYB61      <------ZmHOX2a(1)
--------->ZAT6          --------->ALFIN1   <---------ANAC46 <---------AtMYB61      <------ZmHOX2a(1)
------->MYB52(1)        <---------ZAT6<---------ANAC46----------->HVH21 <---------DEAR3(1)   -------
--->GT1     --------->ANAC46    <------ZmHOX2a(1)   <---------ANAC58   <---------At4g35610<---------DEAR3(1)
 
ataacagtaacttaaacgcgagtactagtggtggaggagttgggtttagtgggtttcttgacggtggtggtttcggcagcggagtaggaggagacggtgg  958200
<- Previous    Next ->

AGI:  At5g03680.1   
Description:  PTL (PETAL LOSS); transcription factor. similar to EDA31 (embryo sac development arrest 31), transcription factor [Arabidopsis thaliana] (TAIR:AT3G10000.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO15958.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN71904.1); contains InterPro domain SANT, DNA-binding; (InterPro:IPR001005)
Range:  from: 957743    to: 961031    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version