AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                           <--------
                                                                                        <---------At4g35610
                                                                                    ------>ZmHOX2a(2)
                                                                                   <---------GLK1(1)
                                                                                   --------->GLK1(1)
                                                                                   <------ZmHOX2a(2)
                                                                                  <---------ARR11(3)
                                                                                  <---------AGP1
                                                                                  <-----------ARR10
                                                                                  --------->GATA12
                                                                                  --------->ARR14(2)
                        --------->YAB1                                            <---------GATA12
                        <---------ICU4                                            --------->ARR11(3)
                <---------O2                           --------->KAN1    --------->ANAC58 <---------DOF5.7(1)
   <---------O2 <---------ALFIN1                      <---------AHL20(2) --------->ANAC58 <---------DAG2
   --------->O2 --------->O2                --------->ARR11(2)         --------->MYB52(1) <---------
------HSFB2a(2) --------->bZIP60(2)         --------->GATA12   ---------->DOF2    <---------ARR14(2)
-HVH21     <-----------GT1            <---------MYB46(3)    <-----------HVH21     --------->RVE1(2)
 
gcgaagacgtcgttttgccacatcgcatcatgagcttgttgttgttgaatcggctgttttattcgtcaaagaagaaacgaaaacagatctcagctttttt  565500
                                                                                                  <-
                                                                                                  --
                                                                                                  <-
                                                                                                  --
                                                                                                  <-
                                                                                                 <--
                                                                                               <----
                                                                                               -----
                                                                                              ------
                                                                                             <------
                                                                                            --------
                                                                                            --------
                                                                             ----------->HVH21------
                                                                             --------->WRKY12-------
                                                                --------->AHL20(2)         <--------
                     --------->GLK1(1)                       --------->CCA1(2)             <--------
                     <---------GLK1(1)                      --------->ARR11(3)            --------->ANAC46
               ---------->DOF2                              <---------ARR11(3)    ------------------
           --------->TOE2(3)  <---------YAB1              ----------->GT1    --------->WRKY38(1)----
           --------->TOE1(3) <---------GLK1(2)      --------->DOF5.7(1)    <---------At4g35610<-----
           --------------->AGL15                   --------->DOF5.7(1)     --------->At4g35610<-----
-DOF5.7(1) <---------------AGL15                   --------->DAG2  --------->RVE1(2)   --------->ARR11(2)
-DOF2     ----------------->AGL2                  ---------->DOF2<---------AHL20(2)    <---------ARR11(2)
 
tgatttcacaaaaaccctaaaaggaattctctgattcttgaaggaagagaaggtaaagggagagatataaaatcaatgggctgacccttgaatacggcgc  565600
                                                               <---------ABI4(2)
--------ARR11(2)                                              ------>NtERF2
------->ARR11(2)                                             ------>NtERF2
--------ARR14(2)                                           --------->LBD16
------->ARR14(2)                                       --------->AtMYB61
--------MYB52(1)                                       <---------ALFIN1
-------SPL7(1)                --------->MYB52(1)       --------->DEAR3(1)
--NtERF2                   <---------O2               --------->MYB46(3)
---->ATERF1(1)          --------->TOE1(2)           <---------ARR11(2)
--->ABI4(2)             --------->DEAR3(1)          --------->ARR11(2)
---DEAR3(1)             --------->TOE2(2)           <---------ARR14(2)
->ATERF1(1)            --------->MYB46(3)           --------->ARR14(2)
->RAP2.3(1)            --------->DEAR3(2)         <xxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
>NtERF2              --------->MYB52(1)           --------->LBD16--------->MYB52(1)
-->DEAR3(1)       <---------At4g35610           <-----------------------TaNAC69(2)
-RAP2.3(1)        --------->At4g35610 --------->LBD16 <---------MYB55(2)
-ATERF1(1)--------->ANAC46 <---------TGA1a      <---------LBD16--------->MYB46(3)                 --
--->WRI1------>ZmHOX2a(1)  --------->TGA1a    --------->ARR11(2)--------->AtMYB61 --------->AtMYB61<
----->DEAR3(1) <---------MYB52(1)  --------->MYB52(1) <---------ABI4(2)        <---------ALFIN1=====
----ATERF1(1) <-------GAMYB--------->O2    --------->YAB1 --------->DEAR3(1)<-----------GT1 ------>NtERF2
----RAP2.3(1) =======================MYC_MYB  <---------ARR11(2)<---------ALFIN1------>NtERF2  -----
 
cgttctggctcctacgcggttagcaaaccgacgagacggaccggaattagaaccggaaccaccgcgaccaccggtgttattgccacctccaatgcctcct  565700
                                                                                <------ZmHOX2a(2)
                                                                                <---------RVE1(1)
                                                                               <---------AGP1
                                                                               <---------ARR14(2)
                                                                               --------->ARR11(2)
                                                                               <---------ARR11(2)
                                                                    <---------ARR11(3)
                                                              --------->bZIP60(2)
                                                              --------->ZAT2   <---------ARR11(3)
       <------ZmHOX2a(2)                                      ===============================bZIP_DOF
       --------->CCA1(2)                                      <---------O2     --------->ARR11(3)
      --------->ARR11(3)                                      <---------ZAT2   <---------GATA12
      --------->GATA12                                        --------->TGA1a  --------->GATA12
      <---------GATA12                                        <---------TGA1a  <-----------ARR10
      <---------ARR11(3)                                      --------->O2     <---------ARR11(1)
      --------->ARR14(2)                                      ----------->RAV1(2)
      <---------ARR11(2)                                      --------->At4g35610
      --------->ARR11(2)                                      <---------At4g35610------>ZmHOX2a(2)
      --------->AGP1                                         ------>NtERF2     --------->ARR14(2)
      <---------ARR14(2)                            <-----------ARR10         <---------CCA1(2)
     --------->GLK1(1)                 --------->YAB1    --------->ANAC46     <---------ARR14(1)
 <------NtERF2<------MYB46(1)       <---------bZIP60(1)  --------->ANAC58   <---------TOE1(2)
 ------>NtERF2<------MYB83          --------->bZIP60(1)  --------->ANAC58  <---------LBD16
 --------->LBD16           <---------GATA12         --------->RVE1(2)--------->KAN1             ----
---->NtERF2<---------MYB52(1)    <---------YAB1    <---------CCA1(2)--------->ARR11(3)          <---
---------DEAR3(1)          --------->GATA12   ----------->HVH21   <<<<<<<GRF7--------->LBD16--------
==============HOX2a_HOX2a  <---------RVE1(2)<---------ANAC55(2) ----------->HVH21<---------DOF5.7(1)
->ZmHOX2a(1)<--------P   ----------->ARR10  --------->ANAC55(2)<---------MYB111(1)<----------DOF2
 
cggccgcgagatccagtaggttttcgattagatttgatgatatcatcaagtgacatatctaagccacctgacatcttcgccggatcttttctccgatatc  565800
                                                    --------->LBD16                     <---------LBD16
                                                   --------->DEAR3(1)                   <---------HSFB2a(2)
                                                 ------->TEIL                           --------->HSFB2a(2)
                                                <---------ALFIN1                  --------->ARR11(3)
                                                --------->ANAC46                  <-----------GT1
                                              --------->ANAC58                    <---------ARR11(3)
      <---------STY1(2)                       --------->ANAC58                <---------CCA1(1)
     ------->TEIL            --------->GLK1(1)--------->ANAC55(2)             --------->KAN1
  <---------REM1(1)         --------->GATA12  <---------ANAC55(2)             <---------RVE1(1)
----->HSFB2a(2)             <---------GATA12  --------->ANAC46               <---------RVE1(2)
------HSFB2a(2)   ---------->ID1            <-----------GT1                  --------->ARR11(3)
->GLK1(1)       <-----------RAV1(1)        <---------KAN1   *TSS             <---------ARR11(3)    <
 
gagaaatgtagctagggttttgttgctctgagatttcaaagatggaattacgcaccgcgagagtgagagagagagaaacagatattatcttctcggagaa  565900
                     <---------ICU4
                     --------->YAB5
                     --------->YAB1
                    <---------ATHB12
                    <---------YAB5
               <----------DOF2                                                          <----------DOF2
             --------->At4g35610                        <-----------GT1                <---------DAG2
         --------->AtMYB61                         <---------ANAC58                    <---------DOF5.7(1)
        --------->ANAC46 <------------CBF          --------->ANAC55(2)           --------->WOX13(2)
      <---------ALFIN1 <---------YAB1             <---------TOE2(2)           <---------YAB1     ---
  XXXXXXXXXXXXXXXXXXXX>MIR852                     <---------TOE1(2)    --------->LBD16 <----------DOF2
---------YAB1<---------At4g35610<-----------RAV1(1)<---------ANAC58  ----------->RAV1(2)<---------DOF5.7(1)
 
ttacgataaacacctcagctttaatcaatattgttttgttgcccttaaactcttacgttttactaaatagacccctgagttcttaatgggccttttggac  566000
                                                           ------>NtERF2
                                                          --------->LBD16
                                                          ------>NtERF2
                                                  <-----------GT1
                                               <---------AHL25(1)
                                               --------->AHL20(3)
                                               <---------AHL20(2)
                                               --------->AHL12(3)
                                               <---------AHL20(3)
                                             --------->AHL12(2)
                                             --------->AHL12(3)
                                             <---------AHL12(3)
                                             <---------AHL20(2)
                                          <---------AHL25(2)
                                          --------->AHL25(2)
                                          <---------AHL20(2)
                                          <---------AHL20(3)
                                          --------->AHL20(3)
                                          --------->AHL20(1)                  --------->ARR11(3)
                    <---------YAB1        <---------AHL25(1)            <---------YAB5
          --------->ALFIN1                --------->AHL25(3)          <---------ICU4
     <<<<<<<<<<<<<<<<<LFY                --------->YAB1 <---------LBD16--------->RVE1(2)
     >>>>>>>>>>>>>>>>>LFY   <---------ALFIN1 <---------AHL25(2)      --------->ICU4    --------->ANAC58
    --------->RVE1(2)      --------->ZAT18<---------AHL20(1)       --------->YAB1      --------->ANAC58
 --------->AHL20(3) ------>ZmHOX2a(1)    --------->AHL20(2)>>>>>>>>>>>>>>>>>LFY   --------->ZAT18
 <---------AHL20(3)--------->TOE2(3)    <---------YAB1  --------->SPL7(1) ---------->DOF2 <-------TEIL
------>YAB1  --------->PCF5<---------ZAT18<---------AHL25(3)      <---------YAB1  <---------ETT(2)
 
tcataaaaatccagtggcccatcctcattgtccacttcaacttattatatttttttccctccggccattgtcataatcaaagatgtggacaagtacatgt  566100
                                                                   <---------TOE2(3)
                                                                   <---------YAB1
                                                                  <---------AHL20(2)
            --------------->AGL15                                 --------->AHL12(3)
            <---------------AGL15                                 --------->AHL20(2)
           <---------ANAC58                                       --------->AHL20(3)
           =========================================================================================
           <-----------------AGL2                                 --------->YAB1              <-----
           <---------ANAC58                                       <---------AHL12(3)       <--------
           <---------ANAC46                                       <---------AHL25(2)   <---------DOF5.7(1)
           ----------------->AGL1                           --------->ANAC46          <---------DOF5.7(1)
           <-----------------AG                             --------->ANAC58         <---------DOF5.7(1)
           <-----------------AGL1                           <---------ANAC55(2)      <----------DOF2
    --------->ANAC55(2)                            <-------TEIL   <---------AHL20(3) <---------DAG2
    --------->ANAC55(1)                        ------->TEIL --------->ANAC55(2)     <---------DOF5.7(1)
    --------->ANAC46                   --------->YAB1       --------->ANAC58   <---------WRKY38(1)
    --------->ANAC58          ----------->HVH21<-------TEIL --------->ANAC55(1)<---------WRKY12
    --------->ANAC58--------->ZAT18  --------->RVE1(2)--------->KAN1          --------->WRKY18(1)
 
gaagcacacgcattgcctgtatgggcacagtatgtgactgtatcacaacgtacatacacattcacgtattaatattagtaagtcaacccttttttttctt  566200
                    <-----------ARR10
                    <---------ARR14(2)
                    --------->ARR14(2)
       <---------WOX13(2)
    <---------------AGL15
    --------------->AGL15
   <-----------------AG                       <---------ANAC55(1)
   <-----------------AGL2                     <---------ANAC46                   ----------->HVH21
   <-----------------AGL3         <---------WOX13(2)                    <----------DOF2
   <-----------------AGL1  <---------ANAC58   <---------ANAC58         <---------DOF5.7(1) ---------
   --------->TOE2(3)--------->ARR11(3)        <---------ANAC58       --------->ARR11(3)    <--------
=====================MADS_MADS    --------->WOX13(2)       <---------ZAT6    <-----------GT1  <-----
-----DOF2           <---------GATA12 <-----------GT1   <---------YAB1<---------ARR11(3)    <--------
---GT1 --------->WOX13(2)  <---------ANAC58 <---------AHL20(2) ---------->DOF2 ----------->RAV1(2)
 
tgtttatctcaatttggaaaacaaatcttgccttgctatttaacaaattacttgtaccatgagtgttaaagacatctttataacctgaccagaagatttt  566300
                                                                                           ---------
                                                                                           <--------
                                                                                          --------->YAB1
                         --------->AHL12(2)                                               <---------ICU4
                         <---------AHL12(2)                                              --------->AHL25(1)
                       <---------AHL12(1)                                                <---------AHL25(3)
                       <---------AHL12(3)                                      --------->YAB5
                       --------->ICU4              --------->AHL20(2)          <---------ICU4
                       --------->AHL12(1)         <---------YAB1               --------->YAB1
                      --------->AHL12(1)   <---------DOF5.7(1)   <---------GATA12<---------bZIP60(1)
                  <---------YAB1           <----------DOF2       <---------GLK1(2)       <---------AHL20(2)
                <---------ICU4         <---------ZAT18           <---------RVE1(2)       --------->AHL25(3)
       <---------HSFB2a(2) <---------AHL20(2)  <---------AHL20(2)--------->GATA12--------->bZIP60(1)
>ARR11(3)       --------->YAB1         --------->ZAT18           --------->ARR14(2)      --------->AHL20(2)
-ARR11(3)      --------->ICU4       <---------ANAC46<---------AHL20(2)        --------->ICU4 <------
----AHL20(2)   <---------KAN1 <---------YAB5   <---------YAB1    <---------ARR14(2)    --------->TOE2(3)
-GATA12--------->HSFB2a(2)<---------YAB1   <---------DAG2 --------->CCA1(2)   <---------ATHB12 <----
 
atgtagaattctagacgaattatgaaatttttaatggttaagtggacttttttattatatgatatacagatttgtattcaaatgatgacacattaattac  566400
<- Previous    Next ->

AGI:  At5g02530.1   
Description:  RNA and export factor-binding protein, putative. similar to RNA and export factor-binding protein, putative [Arabidopsis thaliana] (TAIR:AT5G59950.4); similar to RNA and export factor-binding protein, putative [Arabidopsis thaliana] (TAIR:AT5G59950.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN83715.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO21699.1); contains InterPro domain RNA recognition motif, RNP-1; (InterPro:IPR000504); contains InterPro domain Nucleotide-binding, alpha-beta plait; (InterPro:IPR012677)
Range:  from: 564083    to: 565861    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version