AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                        --------->ANAC58
                                                                                        --------->ANAC58
                                                                                    --------->ANAC58
                                                                          <---------AHL20(2)
                          <----------DOF2                                 --------->AHL12(1)
                     <---------bZIP60(2)                                 --------->AHL20(2)
                     <---------ANAC46                                    <---------AHL25(1)
           --------->RVE1(2)                                --------->KAN1<---------AHL25(3)
     <-----------GT1 <---------ANAC58                  <---------ATHB12  --------->AHL12(3)
<----------DOF2      <---------ANAC58            --------->ANAC46        --------->AHL25(1)
-------->ID1     <---------WOX13(1)            --------->KAN1      --------->ANAC46 --------->AtLEC2
---------GT1    --------->WOX13(2)        ----------->GT1  --------->AHL20(2)       --------->ANAC58
-----AHL20(2)   <---------WOX13(2)        <---------ZAT6--------->YAB1   --------->AHL25(3) --------
 
tttctttttatccatagctaattgacgtgctttaaaaccgtgagagtgttatatgccagtcataaattcccagcaaataaatcggccatgcaagaaaatt  18290800
                                                   <---------ICU4
                                                   <---------AHL20(3)
                                                   <---------AHL20(2)
                                                   --------->AHL20(2)
                                         <---------YAB1 <-----------GT1
                                         ----------->HVH21    <---------DOF5.7(1)
                              <---------ANAC46     <---------AHL12(1)
                              --------->ANAC55(2)  --------->AHL12(1)                  <---------ICU4
                              <---------ANAC55(2)  --------->AHL20(3)                 --------->AHL12(1)
                              <---------ANAC58     <---------AHL25(2)                 <---------AHL12(1)
                              ==========================================bZIP_DOF      <---------AHL20(2)
                              <---------ANAC58     --------->AHL25(1)                --------->AHL12(2)
                              --------->O2         <---------AHL25(3)                <---------AHL12(2)
                              <---------bZIP60(2)  --------->AHL25(2)                <---------AHL20(3)
                              <---------ANAC55(1)  <---------AHL25(1)                --------->AHL20(3)
                              <---------TGA1a     --------->AHL12(2)                 --------->AHL25(2)
                              --------->TGA1a --------->At5g28300                    <---------AHL25(2)
                ----------->GT1  <-----------HVH21--------->ICU4                  --------->AHL20(2)
       --------->GLK1(2) <---------ANAC55(2) ----------->GT1 <----------DOF2  ---------->DOF2
 <---------ATHB12--------->At5g28300   <---------ICU4 <-----------GT1         --------->DOF5.7(1)
->AHL12(1)    --------->ZAT18 <---------O2  --------->ZAT6  <---------DOF5.7(1) ----------->GT1
 
tgaaatcaagaatcaagggcagtgaattcagtaacgtgtcaattctgacagtaattttttctctctttttttcaaaaaaaaaaaagaaaataatcgcata  18290900
                                         --------->YAB1
                                         ----------->GT1             ----------->GT1
                                      --------->YAB1            <---------AHL20(2)
                                 <---------YAB1                --------->AHL20(2)
                              <---------AHL20(2)               <---------AHL20(2)
                             <---------AHL12(3)              --------->WOX13(2)
                             --------->AHL25(2)              <---------WOX13(2)
                             --------->AHL20(3)             --------->ATHB51                  ======
       <---------AHL20(2)    --------->AHL20(2)             --------->AHL20(2)                <-----
      <---------AHL25(1)     <---------AHL20(3)          --------->TOE1(3)                    ------
      <---------AHL12(3)     --------->AHL25(1)          --------->TOE2(3)                  --------
      <---------AHL20(2)     --------->AHL12(3)          --------->YAB1                 <---------KAN1
      --------->AHL20(2)  <---------AHL12(2)          --------->WOX13(1)                <---------AHL12(1)
      --------->AHL25(1)  --------->AHL12(2)         <---------WRKY38(1)            <---------TOE2(3)
      <---------AHL25(3) <---------AHL20(2)         --------->WRKY18(1)  <---------RVE1(2) <--------
 
caaaacaaattatatggctattttctgttaaattttataaatgatagtaattttagtcaaccataatttaaaatgtgattttgttttaagaatttttccc  18291000
                                                 <---------AHL12(2)
                                                 --------->AHL12(2)
                                                --------->AHL20(2)
                                                <---------AHL25(3)
                                               <---------AHL12(3)
                                               --------->AHL20(2)
                                               --------->AHL12(3)   --------->ANAC58
                                               <---------AHL20(2)   --------->ANAC46
                                               <---------AHL25(1)   --------->ANAC58
                                               --------->AHL25(1)   --------->ANAC55(2)
                                               --------->AHL12(1)  <---------------AGL15
                                               <---------AHL12(1) <-----------------AG
                           ----------->GT1     --------->AHL25(3) <-----------GT1
                       <---------ARR14(2)     --------->AHL12(2)  <-----------------AGL1
                       --------->ARR14(2) --------->YAB1      --------->WOX13(2)
             <---------WRKY38(1)         ----------->GT1      <---------WOX13(2)
===================================================================================MADS_MADS       -
------------AGL1   <-------TEIL          <---------YAB1   --------->TOE2(3)         <---------ANAC46
----------->AG <---------YAB5    <---------AHL20(2)    <----------DOF2        --------->DAG2     <--
-->ID1      --------->WRKY18(1) --------->AHL20(2)  <-----------GT1--------------->AGL15 -----------
---GT1<---------KAN1--------->YAB1    <---------AHL20(2)  --------->YAB1     ---------->DOF2     ---
 
taagatggcatttcagtcaacattcatatatggtattatatataatgaaaataaataactttcttaatttcacgaaatggaaaagtttagtatagaaaca  18291100
                                              <---------ARR11(3)
                                              --------->RVE1(2)
                                              --------->ARR11(3)
                                           --------->AHL20(3)
                                           --------->AHL12(3)
                                           <---------AHL20(3)
                                         --------->AHL20(3)
                                         <---------AHL12(3)
                                         <---------AHL20(3)                        <---------------AtSPL3
                                         --------->AHL25(1)                        --------------->AtSPL3
                                      <---------ARR11(3)                           --------------->AtSPL8
                          --------->At4g35610--------->RVE1(1)                   --------->ARR14(2)
                          ------------>CBF <---------AHL25(1)                    <---------ARR14(2)
                          <------NtERF2<---------KAN1                           <---------CCA1(2)
            --------->WOX13(2)        <---------RVE1(2)                   ------->GAMYB------->TEIL
            --------->AHL12(2)   --------->DOF5.7(1)                     <------------AtMYB77
-------->YAB5          <------NtERF2----------->GT1                      --------->MYB46(3)    -----
-------ARR11(3)   <-----------RAV1(1) --------->ARR11(3)               --------->ARR11(2)<---------ALFIN1
>GT1        <---------WOX13(2)  ---------->DOF2                   --------->At4g35610 <-----------GT1
------>ARR11(3)<-----------GT1  --------->DOF5.7(1) --------->RVE1(2)--------->At5g28300 --------->ZAT6
 
aatctttagtctcttaatttactggtggcagcaataaaagggatattaatatctctatctacttctctcaactgtaactgcccatatatgtaccactccc  18291200
              --------->TOE2(3)                                                   <---------ARR11(2)
           *TSS                                                                   --------->GLK1(2)
           ----------->RAV1(1)                                                    --------->ARR14(2)
          --------->ANAC46                                             --------->LBD16
        --------->ANAC46                                              <---------HSFB2a(2)
        --------->ANAC58                                              --------->HSFB2a(2)          <
        --------->ANAC58                                             <---------LBD16               -
    --------->RVE1(2)    --------->RVE1(2)                       <---------ARR11(3)             <---
   <---------KAN1  --------->ANAC46                              --------->GATA12 <---------ARR14(2)
---------------->WRI1  --------->RVE1(2)                         <---------GATA12 --------->ARR11(2)
 
tcgagagtatcacacaacataaacccaatctctcactcagactaagacagagtcagaaacaatggcgaaatctccagaaacagagcatccgaacaaagtc  18291300
       --------->ALFIN1       ----------------------->TaNAC69(2)
     <---------ANAC58     --------->ZAT14
     <---------ANAC58   <---------MYB52(1)
     <---------ANAC46  --------->LBD16
   <------MYB83      <---------LBD16                                                              <-
   <------MYB46(1) <---------GATA12                                                              <--
 <--------P        <---------ARR14(2)                 <---------HSFB2a(1)                        <--
<---------ANAC58   <---------ARR11(2)            <---------HSFB2a(2)                             <--
<---------ANAC58   --------->ARR14(2)            --------->HSFB2a(2)                            <---
<-------GAMYB      --------->ARR11(2)            <---------HSFC1(1)                             <---
---------MYB46(3)  --------->GATA12      <-----------GT1     ------>ZmHOX2a(1)               <------
-------->MYB55(2) <---------GLK1(1)  <----------DOF2  --------->HSFB2a(1)                 <---------
-------DOF2       --------->KAN1    <---------DOF5.7(1)     --------->TOE2(3)           <----------DOF2
 
tttggttggggtgctagagacaaatccggtgttctctctccttttcacttctctagaaggtttccttacttctcatcacttcttcttgtttctttaccac  18291400
                                              ----------->GT1
                                             ------>ZmHOX2a(2)
                                           --------->ARR11(2)
                                           --------->ARR11(3)
                                           <---------ARR11(3)
                                           <---------ARR14(2)
                                           <---------AGP1
                                           --------->GATA12
                                           --------->AGP1
                                           <---------GATA12
                                           --------->ARR14(2)
                                           <---------ARR11(2)
                                       <---------TOE2(1)                                   <------MYB46(1)
                                       <---------TOE1(1)                                   <------MYB83
                                   <------MYB46(1)                                     --------->YAB5
   <----------DOF2         <-----------------AGL2                                      --------->ATHB12
--------DOF5.7(1)          <-----------------AGL3                                     <---------YAB5
--------DOF2             <---------GATA12 <---------GLK1(1)                           --------->ICU4
-------DAG2             --------->GLK1(1) --------->GLK1(1)                           <---------YAB1
-------DOF5.7(1)   ---------->DOF2 <------MYB83                             <---------MYB52(1)
------DOF5.7(1)  <<<<<<<<<MYB98   --------->MYB59                          <-------GAMYB <---------WOX13(1)
------DAG2     <---------YAB1  <---------WOX13(2)                         <-----------RAV1(1)      <
---ALFIN1     <---------TOE2(3)--------->WOX13(2)                 --------->MYB52(2)<---------At4g35610
--GT1    ------>ZmHOX2a(1) --------->TOE2(3)<------ZmHOX2a(2)   <---------MYB52(1)  --------->YAB1--
 
ctttttcttttcctgtttatgttaaagaaatctaaatttggtccgagatctgttacaaagttttgctgttcgtttctctgttgtctctgatgattggtct  18291500
                                             ------>ZmHOX2a(2)
                                            <------ZmHOX2a(2)
                                           --------->ARR14(3)
                                           <-----------ARR10
                                           <---------AGP1
                                           --------->ARR14(2)
                                           <---------ARR14(3)
                                           <---------RVE1(2)
                                           <---------ARR14(2)
                                           --------->ARR11(3)
                                           <---------ARR11(3)
        --------->ZAT14                    --------->GATA12
        --------->At4g35610     ----------->HVH21                             --------->ANAC58
        <---------ZAT14       <---------bZIP60(2)                             --------->ANAC46     <
        <---------At4g35610   <---------bZIP60(1)        <---------ANAC46     --------->ANAC58     <
  <-----------GT1             --------->bZIP60(1)   <---------ANAC46    <---------WOX13(1)         <
---------ICU4      ----------->GT1         <---------GATA12       <---------ALFIN1                 -
------->ICU4       --------->YAB1        ----------->ARR10 <---------KAN1 <-----------GT1          -
 
aatttttactctgcagagacaatggtgaaaatgatgtgacagtgaagatcttgttctgtggagtttgccacactgatttacacaccatcaaaaacgactg  18291600
         <-----------GT1                                          <-----------GT1
--------->KAN1                                                 --------->WOX13(2)
---------RVE1(2)                <---------HSFB2a(2)     <---------GLK1(1)            <-----------GT1
---------ARR11(2)      --------->LBD16                  --------->GLK1(1)         <---------AHL12(2)
---------ARR14(2)     <-----------RAV1(2)              <---------RVE1(2)         <---------AHL20(2)
-------->ARR14(2)     <---------LBD16                  --------->ARR11(3)       --------->YAB1   <--
-------->ARR11(2)  <---------ARR11(2)                  <---------ARR11(3)       --------->AHL20(2)
 
gggatactcgtattacccagtagttccagggtaatctcgaaacaaaatttcaaacagagatatcgtatttaacaagttttctattatataacaaaacctt  18291700
<- Previous    Next ->

AGI:  At4g39330.1   
Description:  mannitol dehydrogenase, putative. Identical to Probable mannitol dehydrogenase (CAD1) [Arabidopsis Thaliana] (GB:P42734;GB:Q94K02); similar to mannitol dehydrogenase, putative [Arabidopsis thaliana] (TAIR:AT2G21730.1); similar to unknown [Populus trichocarpa] (GB:ABK94550.1); contains InterPro domain Alcohol dehydrogenase GroES-like (InterPro:IPR013154); contains InterPro domain NAD(P)-binding; (InterPro:IPR016040); contains InterPro domain GroES-like (InterPro:IPR011032); contains InterPro domain Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149); contains InterPro domain Alcohol dehydrogenase superfamily, zinc-containing; (InterPro:I
Range:  from: 18291212    to: 18293377    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version