AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                    <---------ANAC58
                                    <---------ANAC58                                          <-----
                                    <---------ANAC55(2)                                       >>>>>>
                                    --------->ANAC58                                          >>>>>>
                                    --------->ANAC58                            <---------TOE1(2)
                                    --------->ANAC55(2)                        --------->STY1(1)
             <---------ANAC58      <-------TEIL                     --------->ANAC58         -------
             <---------ANAC58      --------------->AtSPL3           --------->ANAC58       ---------
             <---------ANAC46  <---------------AtSPL3              <---------ZAT18 <-------GAMYB
             ----------->GT1   --------->DAG2         <---------STY1(2)        ------>ZmHOX2a(1)
     ---------->DOF2           <---------------AtSPL8 --------->STY1(2)   <---------ZAT2   <--------
  --------->At5g28300         ---------->DOF2        --------->MYB111(1) <---------ATERF1(1) -------
 ----------->GT1    <---------AHL20(2)      <---------RVE1(2)      --------->SPL7(1)<--------P>>>>>>
 <---------MYB46(3)--------->AHL20(2)  ------->TEIL <--------P <---------------AtSPL3    <---------RAP2.6(3)
---------At4g35610<----------DOF2  --------------->AtSPL8      <---------------AtSPL8    ------>NtERF2
 
tgagcggttaaagaaggcgtgatttaatgcatataaagtacgtacttgatacttggtagctagaagttagtacgccctgctcctagggttgccgacttga  15819100
                                                                                               <----
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                                             -------
                                                                                          --------->MYB52(1)
                                                                                          ----------
                                                                                   <---------AHL25(1)
----WRKY18(1)                                             <---------GLK1(2)        <---------AHL20(3)
>>>>WRKY43                                    <---------CCA1(1)                    --------->AHL20(3)
>>>>WRKY26     ----------->GT1               --------->ARR11(3)                    --------->AHL12(3)
-->WRKY38(1) <---------ANAC58                <---------AHL20(1)                    <---------AHL12(3)
>O2     <---------YAB1 <-------TEIL          <---------ARR11(3)                    <---------AHL12(2)
-O2    <---------TOE2(3) <---------------AGL15<---------RVE1(1)                   --------->YAB1   -
---->HVH21   <---------ANAC46      --------->YAB1        --------->KAN1           --------->AHL20(2)
>>>>WRKY38   <---------ANAC58   ----------->GT1   <---------AHL20(2)    <---------YAB1--------->RVE1(2)
 
ccaattcatttatgtttcttgtaaaatacattttggagtaataaccaagatatttaaaacaaattctttctacttatgagttcaataaaaatccaacaga  15819200
                                                                                          <---------ANAC58
                                                                                          <---------ANAC58
                                                                               --------->ARR11(3)
                                                                               --------->RVE1(2)
                                         <---------TGA1a                       <---------ARR11(3)
                                         <---------O2                       <---------AHL12(3)
                                         --------->TGA1a                    --------->AHL12(3)
                                         --------->O2                       <---------AHL12(2)
                                         --------->ANAC55(1)                --------->AHL12(2)
                                         --------->ANAC58                  <---------AHL25(3)
            ------->TEIL          ------>ZmHOX2a(1)                       <---------AHL20(2)
-----ARR14(2)           <---------GATA12 --------->ANAC58                 --------->AHL25(1)
---->ARR14(2)           --------->GATA12 --------->ANAC46                 <---------AHL25(1)
---->ARR11(2)          --------->KAN1    --------->ANAC55(2)              --------->AHL20(2)
-----ARR11(2)       --------->LBD16    <---------ALFIN1                   --------->AHL25(3)
>GAMYB  --------------->AtSPL8   <---------ANAC58                ------->TEIL --------->RVE1(1)
->RAV1(1)  <-----------GT1       <---------ANAC58 <---------ARR11(3)      <---------AHL12(3)
---------->GT1     <---------ANAC46--------->AtLEC2           <---------ATHB12--------->CCA1(1)
 
actggtgactatatgtactctaccgtagattccagtccttgcacacgttacaatgtcttacacaaatgaatgcagaaataaatatctatacgagcttgta  15819300
                             ---------->DOF2                                            <----------DOF2
                         ------------------------>ANAC81                            <---------GLK1(2)
                         --------->ANAC58                                           --------->ARR11(3)
               <---------AHL12(2)                         <---------ANAC46          <---------ARR11(3)
             --------->AHL20(3)                           <---------ANAC58        ----------->ARR10
             --------->AHL25(1)                           <---------ANAC58        --------->DOF5.7(1)
             --------->AHL20(2) --------->YAB5     <---------ANAC46             ---------->DOF2
             <---------AHL20(3)--------->DOF5.7(1) <---------ANAC58          <----------ID1 <-------
  <-----------HVH21      --------->ANAC58          <---------ANAC58   ----------->GT1   --------->TOE2(3)
 
taagtcgtcacatcaaaaaaataagaagaagcaaaagattagaaaaacatcatctcgtgtttcgcgttagaaaatgaaaaacgaaaagatactttaaaat  15819400
                   ------>MYB46(1)
                 <---------MYB46(2)
                 <---------MYB111(1)
                 --------->AtMYB61                                              --------->ARR14(2)
                 --------->MYB46(3)                                             --------->ARR11(2)
                 --------->DEAR3(1)                                          <---------ANAC46
                 <---------MYB111(2)                                     --------->ARR11(2)
              --------->ANAC58                                           <---------ARR14(2)
              --------->ANAC46                  <---------ZAT18          <---------ARR11(2)
              --------->ANAC58                  <---------PCF5           --------->ARR14(2)
            --------->ANAC46           <-----------GT1                --------->ANAC58
          <-----------GT1   <---------RVE1(2)   --------->PCF5        --------->ANAC58           <--
    <---------TOE2(3)     <---------TOE2(2)     --------->ZAT18       <---------ANAC55(2)     ------
    <---------YAB1 ------>MYB83--------->GLK1(2)--------->PCF2      <---------ALFIN1     <---------KAN1
    <---------YAB5 -------->P  --------->RVE1(2)<---------PCF2   --------->ANAC46  --------->ANAC46
--------->WOX13(2)--------->MYB55(1)----------->TBP           <---------ARR11(2)<---------ARR14(2)
--YAB1--------->TOE2(3)--------->TOE1(1)  --------->TOE2(2)   --------->ARR11(2)<---------ARR11(2)
 
tgtagttaacattatacacaccaacctcgtagataatctatataacctatgggccctctggtctgtttccaccacgtataccgtatacgagagtatgtat  15819500
                   <------------CBF                                                             ----
                   <---------WOX13(2)                                                           <---
              --------->TOE2(3)                                                                 <---
              --------->TOE1(3)                                              ----------------->AGL1
            --------->ARR11(3)                                               ----------------->AGL2
            <---------ARR11(3)                                               ----------------->AG
     <---------ZAT6--------->WOX13(2)                                    --------->KAN1         <---
     ----------->GT1  --------->ATHB12                                   --------->HSFB2a(1)    ----
-------AHL20(2)  <---------AHL20(2)                                      <---------HSFB2a(1)    ----
->TEIL--------->TOE2(3)    *TSS   --------->YAB1                        <---------YAB5          <---
 
ataatgtaatgttaaaatcttaaattgatttcataaatcatagagagagagagagagagagagagagagtttggaaacattccaaaaccagaactcgata  15819600
                                                                                          --------->AHL12(1)
                                                                                          <---------AHL25(2)
                                                                                          <---------AHL12(1)
                                                                                         <---------AHL12(2)
             --------->ATHB12                                                           --------->AHL12(2)
             --------->YAB1                                                             <---------AHL20(3)
            <---------YAB5                                                              <---------AHL20(2)
            <---------YAB1                                                              <---------AHL25(2)
      ---------->DOF2                                                                   <---------AHL20(1)
  <-----------GT1                                        ---------->DOF2                --------->AHL12(3)
----->AHL25(3)                                      --------->ANAC46                    --------->AHL25(2)
------AHL12(3)                                <----------DOF2                           --------->AHL20(3)
------AHL25(2)                  <----------DOF2     --------->ANAC58                   --------->YAB1
------AHL20(2)                 <---------DOF5.7(1)  --------->ANAC58                  <---------YAB1
----->AHL25(1)               <---------ARR11(3)   <---------ALFIN1                   --------->AHL20(2)
----->AHL12(2)           <---------ARR11(3)  <---------DOF5.7(1)               <-----------GT1
------YAB1  <---------KAN1   --------->ARR11(3) <-----------GT1       --------->KAN1 --------->AHL20(3)
 
ttatttcaccaaagaatgatagaaacaagaactatctttttataaaactctttacaccccaaaagaaaatgtctcactcgttttgccttataatatttct  15819700
            <---------GATA12
            --------->RVE1(2)
            --------->ARR14(2)
            <---------ARR14(2)
            --------->GATA12                                                           --------->DOF5.7(1)
            <---------ARR11(1)                                                         --------->DAG2
           <---------CCA1(2)                                                          ---------->DOF2
        ------->GAMYB                                                        <------NtERF2
      -------->P                                                           --------->ANAC58
     ------->GAMYB                 <---------AHL12(2)                      --------->ANAC46
    <---------MYB111(2)        --------->YAB1                              --------->ANAC58
    <---------MYB55(2)         --------->AHL20(2)                         --------->SPL7(1)
    --------->MYB46(3)        <---------ATHB12      ----------->HVH21     <---------ORA47(1)
 --------->MYB46(3)    --------->RVE1(2)  --------->ZAT14                 --------->RAP2.6(3)     <-
 
ttcaacaacaacccaaatctacaaaaaatcccaataaaaaaaaacttcagtctgtttgacattttgtcgaacacttggacggcatcacaaaaagctctaa  15819800
                            ----------->HVH21
                            <---------ETT(1)
                    <-------TEIL
                  <---------GATA12
                  --------->GATA12
                  <---------ARR14(2)                             <---------CCA1(2)        <---------LBD16
                  <---------ARR11(2)                          --------->LBD16            --------->ALFIN1
                  --------->ARR11(2)                   --------->At4g35610             <---------At4g35610
                  --------->ARR14(2)              --------->YAB1--------->REM1(2)      --------->At4g35610
                  <---------GLK1(2)              <---------AHL12(1)          <---------ANAC58
                 --------->KAN1                 --------->AHL20(2)  <---------ANAC58   <---------ZAT2
               <---------ANAC46                 <---------AHL25(2)  <---------ANAC46   --------->ZAT2
               <---------ANAC58                 <---------AHL20(3)  <---------ANAC58  <---------ARR14(2)
               <---------ANAC58                 --------->AHL25(2)<---------ARR11(2)  --------->ARR14(2)
   --------->YAB5<------NtERF2                  --------->AHL20(3)<---------ARR14(2) <------ZmHOX2a(1)
---------DOF2 <---------LBD16              ----------->GT1   <---------ANAC46<---------ANAC58
 
actttctgactaccaatggcggattcgtcttccgacaaggagaagaaggaaaataataagcagcccgtgtatcgtggagtccgtatgaggagctggggaa  15819900
                                                                                              <-----
                                                                                             ------>NtERF2
                                                                                             <<<<<<<
                                                                                             <<<<<<<
                                                                                             <------
                    --------->TOE1(2)                                                        <<<<<<<
              --------->HSFB2a(2)                                                            <<<<<<<
              <---------HSFB2a(2)                                                            <------
            <-------TEIL                                                                     <<<<<<<
           --------->GLK1(2)                                                                <-------
           --------->CCA1(2)                                                                <-------
           --------->ARR14(1)                                                               <-------
          --------->ARR11(2)                                                                <-------
          <---------RVE1(2)                                                                 <-------
          --------->ARR11(1)                                    <------NtERF2              ---------
          <---------ARR11(2)                                   --------->LBD16             <------NtERF2
          <---------ARR14(2)                                  <---------ANAC46           -----------
          --------->GATA12                                    <---------DEAR3(1)       --------->TGA1a
          <---------GATA12                         <---------DOF5.7(1)                 --------->O2
          <---------GLK1(2)                        ==============================================bZIP_DOF
          --------->ARR14(2)                       <---------DAG2<---------ARR14(2)    =============
         <---------GLK1(1)                         <----------DOF2     <---------RVE1(2) --------->ALFIN1
         --------->KAN1                    <---------ANAC58  <------NtERF2             <---------O2
         --------->GLK1(1)            <---------KAN1         --------->ATERF1(1)       <---------TGA1a
         <---------HSFB2a(1)         <---------GATA12        <---------LBD16           <---------bZIP60(2)
         <----------TaMYB80          --------->GATA12       <---------ATERF1(1)        <---------ANAC58
         --------->HSFB2a(1)         <---------ARR11(2)     ------>NtERF2              <---------ANAC46
        ----------->ARR10            --------->ARR11(2)     <---------RAP2.3(1)        <---------ANAC58
     <---------ANAC46                <-----------ARR10     <---------RAP2.3(3)      --------->ANAC46
   <---------ARR14(2)                --------->GLK1(2)     <---------ATERF1(2)    xxxxxxxxxxxxxxxx>smallRNA(s)
   --------->ARR14(2)                <---------ARR14(2)    <---------DEAR3(1)  <---------At4g35610 -
   <---------ARR11(2)               <---------GLK1(2)     --------->SPL7(1) <---------ANAC58<-------
   --------->ARR11(2)   <------ZmHOX2a(1)  <---------ANAC58--------->ATERF1(2) --------->At4g35610<-
  <---------GLK1(1)--------->DEAR3(2)--------->ARR14(2) ----------->HVH21   <---------ANAC58--------
 
aatgggtatcggagattcgcgaaccgaggaagaaatcgagaatctggctcgggacttttccgacggcggagatggctatgcgtgctcacgacgtggcggc  15820000
<- Previous    Next ->

AGI:  At4g32800.1   
Description:  AP2 domain-containing transcription factor TINY, putative. Identical to Ethylene-responsive transcription factor ERF043 (ERF043) [Arabidopsis Thaliana] (GB:Q9M080); similar to transcription factor [Arabidopsis thaliana] (TAIR:AT2G25820.1); similar to TINY-like protein [Populus trichocarpa] (GB:ABQ62969.1); contains InterPro domain DNA-binding, integrase-type; (InterPro:IPR016177); contains InterPro domain Pathogenesis-related transcriptional factor and ERF, DNA-binding; (InterPro:IPR001471)
Range:  from: 15819528    to: 15820875    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version