AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                   --------->RVE1(2)
                                   <-----------GT1
                                <---------AHL12(2)
                                --------->AHL25(2)
                                <---------AHL25(2)
                               -------->ATHB1
                               --------->YAB1
                               <---------ICU4
                               -------->HAHB4
                               <---------AHL20(2)
                               <---------AHL25(3)
                               --------->AHL12(1)
                              <---------YAB5
                              --------->ICU4
                              <---------ATHB51
                              <---------YAB1
                              --------->AHL25(3)
                             <---------WOX13(2)
                             --------->WOX13(2)
                             --------->AHL12(2)
                             <---------AHL12(2)
                           --------->AHL20(2)
                           <---------AHL20(2)
                         --------->TOE2(3)--------->AHL12(3)
                         --------->WOX13(2)<---------YAB1
                         <---------WOX13(2)<---------AHL20(2)               <---------WOX13(1)
                       <---------AHL20(2) --------->AHL20(2)               <---------WOX13(2)
                  --------->AHL12(2)     <---------DOF5.7(1)               --------->WOX13(2)
                  <---------YAB5--------->AHL12(2)                        --------->ATHB51
                  <---------YAB1<---------AHL20(3)                        --------->ATHB12
               <---------MYB52(1)<---------YAB1                          <---------YAB1
              <-------GAMYB<---------AHL25(1)                            --------->ICU4
------->DOF5.7(1) --------->ICU4--------->AHL20(3)           --------->ARR11(2)
------>DOF2  <---------MYB46(3)--------->ATHB51              <---------ARR14(2)
--->ZAT18    <---------DEAR3(2)<--------HAHB4                <---------ARR11(2)
--->AGL1  <-----------HVH21--------->AHL25(3)             <---------ANAC55(2) --------->YAB1
--->AGL2 <-----------RAV1(1)--------->YAB1--------->AHL20(3) --------->ARR14(2)
--->AG   ------>ZmHOX2a(1) --------->AHL25(1)             <---------ANAC46<---------ICU4 <---------AtLEC2
 
aaaggcacagtcctgtcggttattatttcattaattattatccatttttattagttttgtaacgtatacgagcgtcataattgataactgatgcatggtt  15510400
                                                                                          --------->TOE2(3)
                                                                                         --------->ANAC58
                                                                                         --------->ANAC58
                                                                                     <---------AHL20(2)
                                                                                    --------->AHL12(2)
                                       --------->YAB1                               <---------AHL12(2)
                                      <---------YAB1                                <---------WOX13(2)
                               <---------ARR11(3)                                --------->AHL20(2)
                               --------->ARR11(3)                              ----------->GT1
                             ------->TEIL   --------->KAN1                   ------>MYB46(1)
                <---------AHL20(2)<----------DOF2                            ------>MYB83--------->ANAC46
                --------->ATHB12 <---------DOF5.7(1)              --------->CCA1(2) --------->WOX13(2)
    ----------->GT1     <---------AtLEC2 <---------YAB5---------->DOF2   >>>>>>>>>MYB2  <---------TOE2(3)
 
tcagacatagaaaaaacatttattgatgcatgaacatctttataatggtattcgaacaaaaagaaaacgatatgaaaaccaaatgtaaataaacgtaagt  15510500
                                                                         <---------KAN1
                                --------->AHL20(2)                   --------->AHL20(2)
                                <---------AHL20(2)               <---------AHL25(3)
                              --------->WOX13(2)                 <---------AHL20(2)
                              <---------WOX13(2)                 --------->AHL25(2)
                             <---------ICU4                      --------->AHL20(1)
                            <---------YAB1                       --------->AHL20(2)
                            --------->ICU4                       <---------AHL25(1)
                          --------->YAB5                         <---------AHL25(2)
                  --------->AHL12(1)                             --------->AHL12(1)
                  <---------AHL25(3)                             <---------AHL12(1)
                  <---------AHL20(2)                            --------->AHL25(1)
                 <---------AHL25(1)                             --------->AHL12(3)
                 --------->AHL25(3)                             --------->AHL25(2)
                 --------->AHL25(1)                             <---------AHL25(2)
                 --------->AHL12(3)                xxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
                 <---------AHL12(3)     <---------ARR14(2)      <---------AHL12(3)
                 --------->AHL20(2)    --------->AHL12(1)       --------->AHL25(3)               ---
                --------->AHL12(2) <---------TOE2(3)            <---------AHL25(1)              <---
           ----------->GT1--------->YAB1--------->ARR14(2)      --------->AHL20(2)         <--------
        ---------->DOF2  <------ZmHOX2a(2)        xxxxxxxxxxxxxxxxxxx>smallRNA(si3)     ----------->RAV1(1)
 
gaaatcaaactgaaaggaaaataaatcgatcataatttaagaaaatttgctaaaaaaaaaaaaaaaaaaaaattgaatatgagcgatgaaacaacatatt  15510600
                                                                   --------->MYB59
                                                              <---------AHL12(3)
                                                              <---------AHL20(2)
                                                              --------->AHL25(1)
                                                              --------->AHL20(1)
                                                              --------->AHL20(2)
                                                              <---------AHL25(3)
                                                              <---------AHL12(1)
                                                              <---------AHL25(1)
                                          --------->ANAC46    --------->AHL12(1)
                 <---------WOX13(2)      --------->ZAT18      <---------AHL25(2)
                 --------->WOX13(2)    <---------ZAT14        --------->AHL25(3)
               <---------YAB1          --------->ZAT14        --------->AHL25(2)
  <------ZmHOX2a(2)                    --------->ZAT18       --------->AHL25(2)
  ====================HOX2a_HOX2a      <---------ZAT18       <---------AHL25(1)
 <---------ARR11(3)        --------->MYB59--------->ANAC58   <---------AHL25(2)
 --------->RVE1(2)<---------WOX13(1)------>ZmHOX2a(1)        --------->AHL12(3)
 --------->ARR11(3)     <---------WOX13(2)--------->ANAC58   --------->AHL25(3)
------->DOF2   ------>ZmHOX2a(1)  ----------->RAV1(2)        --------->AHL20(2)              -------
------AHL20(2) --------->ICU4   --------->ANAC58             <---------AHL12(3)    <---------YAB1
-ARR11(3)     <---------MYB59   --------->ANAC58             --------->AHL25(1)  --------->YAB5  ---
 
aaaagatcaaactaagtcctaattgaaaattaggcactcctgtgcacacaaaaaaaaaaaaaaaaaaaattaggctctccaagatgatgactgaaattta  15510700
                                                          <---------AHL12(2)
                                                         --------->AHL25(1)
                                                         --------->AHL25(2)
                                                         <---------AHL20(3)
                                                         <---------AHL25(2)
                                                         <---------AHL20(2)
               --------->DOF5.7(1)                       --------->AHL20(3)
               --------->DAG2                            --------->AHL20(1)
        <-----------GT1                                  <---------AHL20(1)
    <---------AHL25(3)                            --------->CCA1(2)
    <---------AHL20(2)                            --------->GLK1(2)
    -------->HAHB4                               <---------GATA12
    <---------AHL12(1)                           --------->ARR14(2)
    <---------ICU4                               --------->GATA12
    --------->AHL12(1)                           <---------ARR14(2)
   <---------ATHB51                              <---------GLK1(2)
   <---------YAB1                               --------->KAN1
   <---------YAB5                             --------->HSFB2a(2)
   --------->ICU4                        <---------MYB46(3)  <-----------GT1
   <---------ATHB12 --------->ANAC58     --------->KAN1  --------->AHL20(2)
  <---------AHL12(2)--------->ANAC58 --------->DAG2<-------TEIL                                -----
  --------->AHL12(2)<---------KAN1   <---------TOE2(3)  --------->AHL20(2)            >>>>>>>>>TBF1
-->AHL20(2)   --------->DOF5.7(1)    --------->DOF5.7(1)--------->YAB1                <xxxxxxxxxxxxx
------>ZAT6  ---------->DOF2       ---------->DOF2--------->ARR14(1)                 <xxxxxxxxxxxxxx
 
agactaattattcaccaaaaggcatgaaacaacatactaaaaggttgttcgagattcgattatattaccatgagagaccatagagagaagaagaacaaca  15510800
                                                                              <---------RVE1(2)
                                                                             ----------->TBP
                                                                           --------->AHL12(3)
                            <----------DOF2                                --------->AHL20(2)
                            <---------DAG2                                 <---------AHL12(3)
                         <-----------GT1                                   <---------AHL20(2)
                 >>>>>>>>>>>>>>>>>LFY                                      --------->AHL25(1)
                --------->ANAC58       <---------ZAT6                      <---------AHL25(1)
------>RAV1(1)  --------->ANAC58   <---------YAB1                          <---------AHL25(3)
xxxsmallRNA(i)  --------->ANAC46<---------YAB1              <<<<<<<ZML2  <-----------TBP  <---------KAN1
xxsmallRNA(i)   ------->GAMYB   <---------AHL20(2) --------->ALFIN1----------->GT1  ------->TEIL  <-
 
acaaaacatttaagagcaaacgccattgttacttttttattagtgtttttagaggtggagctagaacgagaggtgaatttatatatgcatcgcatatgtt  15510900
                                    <---------ANAC46
                                    <---------ANAC58
                              <-------TEIL
                             --------->ARR14(1)
                             --------->CCA1(2)
                            <---------ARR11(2)                                                    <-
                            <---------ARR14(2)                                                    --
                            <---------RVE1(2)                                                     --
                            --------->ARR11(2)                                                    <-
                      <---------AHL25(3)                                                          --
                     <---------AHL25(1)                                                           --
                     --------->AHL20(2)                                                           <-
                     <---------AHL12(1)                                                         ----
                     --------->AHL12(1)                                                         <---
                     <---------AHL20(2)                                                         <---
                     --------->AHL12(3)                                                         ----
                     --------->AHL25(1)                                                         ----
                     <---------AHL12(3)                                                      -------
            ------>NtERF2   --------->ARR14(2)                                             ---------
         <---------At4g35610--------->ARR11(1)  --------->AHL20(2)                       ---------->DOF2
   <---------CCA1(2) <---------AHL25(3)         --------->AHL20(3)                  <----------ID1--
 --------->YAB1    <---------WOX13(2)           <---------AHL20(3)                  --------->ANAC58
 <---------ICU4    --------->WOX13(2)      <-------TEIL                        <---------------AtSPL8
<---------YAB5--------->TOE2(3)--------->ANAC55(2)              <---------WOX13(2)  --------->ANAC58
<---------ATHB12 --------->AHL20(2) <---------ANAC58            --------->WOX13(2)  ----------->GT1
----------GT1 --------->TOE1(3)<---------ANAC55(2)          --------->YAB1 <---------KAN1--------->DOF5.7(1)
 
ttaatcatctcttgctgccttaaattatatagatacgtttcttgagttcataaaaatagagaaacataatttagacgaatatagagaacgaaaaaagaaa  15511000
 --------->AHL25(3)
 --------->AHL20(1)
 <---------AHL25(1)
 --------->AHL25(2)
 <---------AHL25(2)
 --------->AHL25(1)
 <---------AHL20(3)
 <---------AHL20(1)
 --------->AHL20(2)
 <---------AHL20(2)
 --------->AHL20(3)
--------AHL25(3)
------->AHL20(2)
------->AHL12(3)
--------AHL12(3)
------->AHL20(3)
------->AHL25(1)                                                                                  <-
--------AHL20(3)                                                                               <----
----->AHL20(2)           ----------->GT1                                        ------------>CBF  <-
------AHL20(3)         <------------CBF                             ----------->GT1            -----
------AHL25(2)      --------->AHL20(2)                          <---------TOE1(3)              -----
----->AHL20(3)    ----------->GT1                              ---------->DOF2 --------->ANAC46<----
----->AHL25(2)    --------->ANAC58                      <------------CBF       <-----------------AGL1
-->AHL20(2)       --------->ANAC58                   ------------>CBF    <---------WOX13(2) <-------
-->GT1     --------->ZAT14                        ---------->ID1<---------TOE2(3)          <--------
------->AHL25(2)  <---------ANAC55(2)    ---------->ID1 <---------WOX13(2)<---------YAB1   <------NtERF2
 
ataatataatatactatagtcaagtaaattgtttatagttttttgttttttttgtcgtcaattgtttaaagttgtttattatacacaatttggcagcgta  15511100
                                          --------->YAB1
                                         --------->AHL20(2)
                                         <---------AHL20(2)
                                         <---------AHL25(3)
                                        --------->AHL25(3)
                                        --------->AHL25(2)
                                        <---------AHL25(1)
                                        <---------AHL20(1)                       <----------DOF2
                                        --------->AHL20(1)                       --------->TOE2(3)
                                        --------->AHL20(2)                       --------->TOE1(3)
                                        --------->AHL20(3)                 --------->YAB5
                                        --------->AHL25(1)                 <---------ICU4
        <---------ANAC55(2)             <---------AHL20(3)        <---------AHL20(3)
--------AHL20(2)                        <---------AHL20(2)        --------->AHL12(3)
-----ARR14(2)                <---------AHL25(3)         --------->ARR11(3) --------->YAB1
----------GT1                <---------AHL25(1)         <---------AHL20(1)<---------ATHB12
---->ARR14(2)                --------->AHL25(1)       --------->AHL12(2)  <---------YAB5
---->ARR11(2)                <---------AHL20(2)    --------->AHL20(2)   --------->WOX13(1)
-----ARR11(2)                --------->AHL20(2)  ----------->GT1  --------->AHL20(3)
--ANAC46--------->ANAC55(2)<---------WOX13(2)--------->YAB1      --------->AHL20(2)
-At4g35610                 --------->WOX13(2)<---------ICU4      --------->AHL25(3)
 
tttacttcattacttaatatgagactaagaaattaaactacaatttaataataagttaatatatactataaatttcaatcataactttaaaattcaagtc  15511200
                            <-----------GT1
                          <---------AHL25(1)                                  <----------DOF2
                          <---------AHL20(2)                                 <---------DOF5.7(1)
                        --------->WOX13(2)                                  <---------YAB5
                        <---------WOX13(2)                               <---------AHL12(1)
                     <---------AHL25(3)                                  <---------AHL25(3)
                     <---------AHL25(2)                                  --------->AHL25(1)
                     <---------AHL20(2)                                  <---------AHL25(1)
                     --------->AHL20(2)                                  --------->AHL12(1)
                     <---------AHL20(1)                                  <---------AHL20(2)
                     --------->AHL12(3)                                 <---------AHL12(2)
                     --------->AHL20(3)           --------->TOE2(3)    <---------WOX13(2)
                     --------->AHL25(2)         <---------AHL20(2)     --------->WOX13(2)
                     <---------AHL25(1)      <---------AHL12(2)        --------->AHL12(2)
                     --------->AHL25(1)      --------->AHL12(2)       --------->YAB5
                     <---------AHL20(3)<---------TOE1(3)             <---------AHL20(2)<---------CCA1(2)
               <----------DOF2       ---------->DOF2  <---------YAB1 <---------YAB1<-----------GT1
  <---------GLK1(1)  --------->AHL25(3)<---------TOE2(3)  <-----------GT1--------->AHL20(2)
 
ccaagaattcagtttcttctttattttatttaaaccgttttaaaggtttattttcttaatattactacatgtataattaatctttttctcgtttctccaa  15511300
<- Previous    Next ->

AGI:  At4g32090.1   
Description:  galactosyltransferase. similar to galactosyltransferase [Arabidopsis thaliana] (TAIR:AT4G32105.1); similar to LGC1, putative [Oryza sativa (japonica cultivar-group)] (GB:ABA93988.1); contains InterPro domain Glycosyl transferase, family 31; (InterPro:IPR002659)
Range:  from: 15509996    to: 15510826    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version