AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                  --------->DAG2
              ----------------->AGL1
              ----------------->AG
              <-----------------AGL1
          <----------DOF2
         <---------DOF5.7(1)
        <------ZmHOX2a(2)              ------>ZmHOX2a(2)
        <---------RVE1(1)            --------->GATA12
       --------->ARR11(3)      <---------AHL20(3)                                     <---------AHL12(1)
       <---------ARR11(3)      <---------AHL20(2)                                    <---------YAB1
       --------->AGP1         --------->AHL12(1)            <---------ATHB12       --------->YAB5
       <---------RVE1(2)      <---------AHL12(1)           ------>MYB83           --------->ICU4
       --------->GATA12    --------->ATHB12                ------>MYB46(1)     <<<<<<<GRF7
       <---------GATA12    --------->YAB5               --------->MYB46(3)   ----------->HVH21
      <---------GLK1(1)   <---------KAN1               -------->P            ------>ZmHOX2a(1)
 ---------->DOF2  --------->DOF5.7(1)<---------GATA12 --------->WOX13(1)   ----------->RAV1(2)
---->KAN1------>ZmHOX2a(2)--------->ICU4             --------->MYB46(3) --------->KAN1--------->AHL12(1)
->GT1 --------->GLK1(1)   <---------YAB5            <---------ATHB12<-------TEIL  <---------YAB1 ---
 
atgctaaagagatcttttccaaaggtggaatgatttttttgatctaaaacggcccatcaaccaatcttcggtccattatcctgacatgattatttgggct  15479100
                                                                                    <---------AtMYB61
                                                                                 --------->ALFIN1
                                                                                 <-----------RAV1(1)
                                                                               <---------ANAC46
                                                                          --------->At4g35610
                                                                          <---------At4g35610
                                                                        ------>ZmHOX2a(2)
                                                                       <---------At4g35610
                                                                      <---------ARR11(2)
                  --------->At5g28300                                 --------->ARR11(2)
           <----------DOF2                  --------->DOF5.7(1)       <---------RVE1(2)
 --------->AHL20(2)                       ---------->DOF2             --------->ARR14(2)
 --------->AHL20(3)                    --------->YAB1                 <---------ARR14(2)        <---
 --------->AHL25(1)               ------>MYB83                        <---------GATA12        <-----
 <---------AHL20(2)               ------>MYB46(1)                 <---------At4g35610<------MYB83<--
 <---------AHL20(3)            --------->MYB46(3)                 --------->At4g35610<------MYB46(1)
------>REM1(1)   ----------->GT1 ----------->RAV1(1)<---------RVE1(2) --------->GATA12    <---------AtMYB61
 
acatttttttaagtcttttgcagtaaattgttgaaccaacaaaaataaagagttggagttggacctagtagctgatctgctgatgtgttggtgatggtcg  15479200
                                                                           <---------YAB1
                                                                          --------->AHL20(3)
                                                                          <---------AHL20(3)
                                                                        --------->AHL12(3)
                                                                        --------->AHL20(3)
                                                                        <---------AHL12(3)
                                                                        --------->AHL25(3)
                                                                        --------->AHL25(2)
                                                                        --------->AHL25(1)
                                                                        <---------AHL20(3)
                                                                        <---------YAB1
                                                                        <---------AHL20(2)
                                                                       --------->AHL20(3)
                                                                       --------->AHL12(2)
                                                                       <---------AHL25(2)
                                                                       --------->AHL12(3)
                                                                       --------->AHL25(2)
                                                                       <---------AHL20(3)
                                                                       <---------AHL20(1)
                                                                     <---------AHL12(3)
                                                                     --------->AHL20(1)
                                                                     --------->AHL20(3)
                                                                     --------->AHL25(2)
                                                                     <---------AHL12(2)
                                                                     <---------AHL25(2)
                                                                     <---------AHL20(3)
                                                                    <---------AHL25(3)
                                                                    --------->AHL25(2)
                                        --------->KAN1              <---------AHL25(2)
                                        <---------ICU4              --------->YAB1 --------->RVE1(2)
                             --------->ANAC46                       --------->AHL12(3)
       ------>ZmHOX2a(1)     ------>MYB46(1)                        --------->AHL20(2)
  <---------PCF2             --------->ANAC58                       --------->AHL25(1)
 <---------DEAR3(2)          ------>MYB83                           <---------AHL12(3)
<---------TOE1(2)            --------->ANAC58                       <---------AHL25(1)
---NtERF2         --------->TOE1(3)    <---------YAB5              <---------AHL20(2)          -----
----DEAR3(1)     --------->ZAT6        <---------YAB1              --------->AHL12(1)--------->YAB1
-------ANAC46  <-----------GT1    --------->bZIP60(2)     <----------DOF2 <---------AHL25(2)   <----
 
tcgtgggttcctgtcttataaccctagaaaccaagccacttcatcattctcaaattcaatgctttactaaataatattattatcgaaatcaaaatactaa  15479300
                                                                           --------->RVE1(2)
                                                                           <---------ARR11(3)
                                                                           --------->ARR11(3)
                                                                           --------->AHL20(1)
                                                                        --------->AHL12(3)
                                                                        <---------AHL12(3)
                                                                        <---------AHL25(3)
                                                                        --------->AHL20(3)
                                                                        <---------AHL12(2)
                                                                        <---------AHL25(1)
                                                                       <---------AHL20(2)
                                                                       --------->AHL25(1)
                                                                       <---------AHL25(1)
                                                                       <---------AHL25(3)
                                                                       --------->AHL12(1)
                         --------->TOE1(3)                             <---------AHL12(1)
                         --------->TOE2(3)                           --------->WOX13(2)
                  --------->ANAC58                                   --------->AHL12(2)
           <---------GATA12                                        --------->AHL20(2)
           --------->GATA12                                  --------->ZAT18
        --------->AHL25(1)                                   <---------ZAT18
        <---------AHL20(3)                                   <---------ZAT14
        --------->AHL20(3)                                   --------->ZAT14
        --------->AHL12(3)                                <---------ANAC58 <---------AHL20(1)
        --------->AHL20(2)                                <---------ANAC46--------->CCA1(1)
        <---------AHL20(2)                                <---------ANAC58--------->RVE1(1)        <
        <---------AHL12(3)                           <----------DOF2 <---------WOX13(2)         <---
        <---------AHL25(1)                           <---------DOF5.7(1)<---------AHL20(3)    <-----
     ------->TEIL --------->ANAC58                  <---------DAG2 <---------AHL20(2)  --------->AHL20(2)
---->WOX13(2) --------->HSFB2a(2)               ----------->HVH21<----------DOF2    <---------ANAC55(2)
-----WOX13(2) <---------HSFB2a(2)<---------AtMYB61  <---------DOF5.7(1)--------->AHL20(2)   <-------
 
tttagacgtatataaatctagaagcaaaccttaggtgaggtcgaaacagagatgaccttttgcgtgcactttaattaatatcttattacataaaatgtca  15479400
                                           =======================================bZIP_DOF
                                        <---------AHL12(2)
                                       --------->AHL20(2)
                                       <---------AHL25(3)
                                      <---------AHL25(1)                     <---------At4g35610
                                      --------->AHL25(3)                  --------->TGA2(2)
                                      --------->AHL25(1)                 <<<<<<<<<<<AtbZIP1
                                      <---------AHL20(3)                 <-----------HVH21
                                      <---------AHL20(2)                 <-----------TGA1
                                      --------->AHL12(3)                --------->TGA1a
                                      <---------AHL12(3)                --------->O2
                                      --------->AHL20(3)                --------->bZIP60(1)
                                      --------->AHL20(2)                <---------bZIP60(1)
                                      <---------AHL12(1)                ========================bZIP_DOF
                                      --------->AHL12(1)                <---------TGA2(1)
                                     <---------AHL12(2)                 <---------O2
                                     --------->AHL12(2)                 <---------TGA1a
                                    <---------AHL12(2)                  --------->TGA2(1)
                                   --------->AHL20(2)                  ----------->STF1           <-
                                   <---------AHL20(2)                  <-----------STF1           <-
                                   <---------AHL25(3)                 <---------TGA2(2)           --
      <---------ZAT14             --------->AHL20(2)                 ----------->HVH21            --
----------DOF2   --------->KAN1  --------->AHL12(2)                  ----------->TGA1             --
------ALFIN1   --------->TOE2(3)--------->YAB1                  <-----------RAV1(2)          xxxxxxx
------GT1   <-----------GT1  --------->TOE2(3)                <-----------HVH21      <----------DOF2
----HVH21 <----------DOF2    --------->YAB1---------->DOF2  --------->MYB59  --------->At4g35610 <--
 
cactttgagtaaactttacattattctctcatccataataaataaataaagcatactgggttttaggtcaggctgacgtcagcagtttctttgtgtttca  15479500
                                                                          --------->KAN1
                                                                         --------->GATA12
                                                                         --------->ARR11(3)
                                                                         <---------GATA12
                                                                         <---------GLK1(2)
                                ---------->ID1                           <---------ARR11(3)
                             *TSS                              <------MYB46(1)
--------AHL25(2)           --------->GATA12          <-----------RAV1(1) --------->ARR14(2)
--------AHL20(2)           <---------GLK1(2)       <----------DOF2       <---------ARR14(2)     <---
------->AHL25(1)           --------->ARR14(2)      <---------MYB52(1)    <---------RVE1(2)      <---
------->AHL25(2)           <---------ARR14(2)     <---------DOF5.7(1)  ----------->ARR10     <------
------->AHL12(3)    ------->GAMYB            <-------PIF5      <------MYB83 <-----------GT1<--------
xxxxxxxxx>smallRNA(i)      <---------GATA12  ------->PIF5  <---------MYB46(3)        --------->ANAC46
-------DOF5.7(1) --------->MYB52(1)         --------->ANAC46 <---------ANAC46    <----------DOF2<---
 
ttttttttttttttgtaatctaacgctccagatttgttgtcttctccacgagccctttgttgttgttggtaatggagattttcgctctaagtcattgtgg  15479600
                                                                                             -------
      <----------DOF2                                                                        -------
      --------------->AGL15                                                                  <------
      <---------------AGL15                                                                  <------
     <-----------------AGL3                                                                  <------
 <<<<<<<<<TBF1                                                                     --------->WOX13(2)
------ANAC58                                                                  --------->WOX13(2)
------ANAC46                                                 <---------ALFIN1 <---------WOX13(2)
---RAP2.6(2)                                    --------->GATA12        <---------At4g35610  <------
---RAV1(1)                            <---------MYB52(1)  --------->ZAT6--------->At4g35610  -------
------ANAC58                      ------>ZmHOX2a(1)  <----------DOF2<-----------RAV1(1)     <-------
 
cttcttcttctttatttagaaaccaattcatcaactccttcgttatttctaaatctctttgccactacctcttgttgctgcaattgaattggctcaaatc  15479700
         <---------ETT(2)
         <---------DEAR3(1)                                                                ---------
-->ARR11(3)                                                                           --------->WOX13(1)
-->GATA12<---------WRKY12                                                           <---------KAN1
---GATA12--------->ETT(2)                                                           <---------YAB5
-----ARR10              <----------DOF2                                             <---------ATHB12
---ARR11(3)      --------->DOF5.7(1)                                               --------->RVE1(2)
---ARR14(2)    ---------->DOF2         <-----------GT1                         <------ZmHOX2a(2)
-->ARR14(2) --------->ANAC46 <---------ANAC58                                 <---------GATA12
--CCA1(2)<---------WRKY38(1) <---------ANAC58        --------->LBD16          --------->GATA12
 
ttcttcacttggtcgacgtaaagacgactttgacttggtttttaacttcacttctccgtcgaaaactatcccttctcttccgatcgaatcaatcggctct  15479800
                                                                 ------>NtERF2
                                                         <---------ANAC58
                                                         <---------ANAC58
                                                       <-----------GT1
                                                    <---------AHL12(2)
                                                    <---------WOX13(2)
                                                   <---------AHL12(3)
                                                   --------->AHL20(3)
                                                   <---------AHL20(3)
                                                  --------->AHL25(3)
                                                  --------->AHL20(2)
                                                  <---------AHL20(2)
                --------->MYB52(1)             --------->YAB1<---------ANAC58
   --------->ANAC46               <---------MYB52(1)--------->AHL12(2)
   --------->ANAC58              --------->LBD16  <---------AHL12(1) --------->ICU4
   --------->ANAC58       ------->GAMYB--------->KAN1  <---------AHL20(2)
 <---------ALFIN1      <-----------GT1--------->ICU4--------->WOX13(2)   <---------ZAT6           --
<---------REM1(2)--------->DOF5.7(1)--------->YAB5--------->AHL12(1) <---------MYB52(1)        <----
>At4g35610  <---------TOE2(3)  <---------LBD16<---------YAB1 <---------ANAC58   <---------GLK1(2)<--
 
ctctccacacaaaccaaggtaagggttaaccctctccggtgattatgctctgataaatttacttgctcggccattagtgttcagaaacttggtgatttat  15479900
                                       >>>>>>>>>ARR2
                                       >>>>>>>>>ARR1
                                       >>>>>>>>>ARR1
                                       >>>>>>>>>ARR2
                                      <------ZmHOX2a(1)
                                     <---------YAB1
                            <---------LBD16            <---------DOF5.7(1)                       ---
                          <---------GLK1(1)            --------->TOE1(3)                   <--------
                         --------->ARR11(3)            --------->TOE2(3)                   <--------
    --------->AHL12(2)   <---------RVE1(2)             --------->YAB5                  <------------
----->TEIL               <---------GATA12     --------->ICU4                 ----------->GT1     <--
-----YAB1                --------->GATA12----------->GT1<----------DOF2    ---------->DOF2 <--------
-------AtLEC2 ---------->DOF2     --------->ICU4     ------->TEIL       <-----------GT1<----------DOF2
 
gcatgtttttttttgttcaaagaccgtagatttcggaattaggattgtaaaaattgaacctttacatcagtgtttttacaaagttataagctttacttgg  15480000
<- Previous    Next ->

AGI:  At4g32010.1   
Description:  HSI2-L1/HSL1 (HSI2-LIKE 1); transcription factor. similar to HSI2 (HIGH-LEVEL EXPRESSION OF SUGAR-INDUCIBLE GENE 2), transcription factor/ transcription repressor [Arabidopsis thaliana] (TAIR:AT2G30470.1); similar to hypothetical protein OsJ_024584 [Oryza sativa (japonica cultivar-group)] (GB:EAZ41101.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO48871.1); similar to Os07g0679700 [Oryza sativa (japonica cultivar-group)] (GB:NP_001060642.1); contains InterPro domain Transcriptional factor B3; (InterPro:IPR003340); contains InterPro domain Zinc finger, CW-type; (InterPro:IPR011124)
Range:  from: 15479530    to: 15485359    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version