AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                           <-------TEIL
   --------->At4g35610   <---------SPL7(1)
--------At4g35610      <---------------AtSPL8
------->At4g35610      --------------->AtSPL3
-->YAB1                <---------------AtSPL3
--YAB1               --------->DOF5.7(1)                                          ----------->GT1
>AHL12(2)          --------->At4g35610                                        --------->ZAT14
-AHL12(2)       --------->At4g35610                       ----------->RAV1(1) <---------ZAT14
-AHL20(3)   --------->ZAT2--------->CCA1(2)            --------->ANAC46--------->HSFB2a(2)
>AHL20(3)   --------->At4g35610           <----------ID1 <----------ID1<---------HSFB2a(2)
 
cagatgagttgaaacagctagcagaagaggtacgagacagtataagggacaagagtttaggcaacaaaatgtttgtggaagtatacagtgaaataagaaa  15097700
                                                                    <----------ID1
                                                         <---------LBD16
                                                       --------->ARR14(2)
                                                       <---------GATA12
                                                       --------->ARR11(2)
                                                       <---------ARR11(2)
                                                       <---------ARR14(2)
                           <----------ID1              --------->GATA12                  <------MYB83
               --------->CCA1(2)                      --------->KAN1--------->ANAC58     <------MYB46(1)
              <----------ID1                       --------->At5g28300        <---------ARR11(2)
            --------->DOF5.7(1)      --------->GLK1(2)<---------GLK1(1)       <---------ARR14(2)
          ---------->DOF2--------->DOF5.7(1)      ----------->GT1   --------->ANAC46   <--------P
       --------->ANAC58 --------->DAG2           <---------ZAT6     --------->ANAC58<---------TOE2(3)
       --------->ANAC58---------->DOF2   --------->MYB52(1)--------->LBD16   <------ZmHOX2a(1) -----
 
cagtttgagaacgaaaagagacaagagaaagcgagaagagaagctaatggcagtggtaaatccggagagaaacgccaagaggaaactgaggttggcttca  15097800
                         --------->YAB5
                --------->DOF5.7(1)
            --------->ANAC58                       <---------ANAC58
   --------->DAG2       <---------KAN1             <---------ANAC58
  ---------->DOF2--------->DOF5.7(1)          --------->GATA12
 <---------KAN1---------->DOF2             --------->HSFB2a(2)
----->DOF2  --------->ANAC58               <---------HSFB2a(2)   <-----------GT1   ----------->GT1
 
aagaataaagcaaacaagaaaaggagaatgacgagcatgaaattgtctagatgggcttgctcttgaagtaacccttgtatgaaattttgttaatctcata  15097900
                 --------->AHL20(2)
                 <---------AHL25(3)
               <---------AHL12(2)
               --------->AHL12(2)                                         <---------AHL20(2)
       --------->YAB1                                            --------->KAN1                  <--
      <---------ATHB12                                     <---------DOF5.7(1)             ---------
    --------->WOX13(1)     <---------YAB1         --------->KAN4(2)      <---------DOF5.7(1) -------
 --------->ANAC46<---------AHL12(1)              <---------KAN4(1) <-----------GT1    <----------ID1
 --------->ANAC58--------->AHL12(1)       --------->WOX13(2)    <---------AHL20(2)  --------->YAB5
 --------->ANAC58<---------AHL20(2)       <---------WOX13(2)<----------DOF2        ----------->TGA1
 
gtagaagcaatcagagataataaatcacttatgagtctacgtttcaatttgaatgttctcaatcttttttattccattttatctaaatgacgacgaaaga  15098000
                                                             --------->ANAC58
                                                             --------->ANAC58
                                                        <---------ICU4
                                                        --------->YAB1
                                                     --------->YAB1
                                                     <---------ICU4
                ------->GAMYB   ----------------->AGL1 <---------YAB5
          --------->ANAC58      <-----------------AGL1 <---------YAB1                       --------
          --------->ANAC58     <-----------------AG --------->ICU4                        --------->AHL20(2)
  ---------->DOF2          --------->YAB1           <---------YAB5                       -----------
<---------AHL20(2)         <---------ANAC58         <---------YAB1      *TSS  <---------DOF5.7(1)  <
-------GATA12 --------->At4g35610                 --------->YAB1   <-----------RAV1(1)   <----------
->DOF2  ---------->DOF2    <---------ANAC58      <---------YAB5   <---------TOE2(3)   --------->ZAT6
-->DOF5.7(1) --------->MYB52(1)=====================================================================
 
gatttaaaagcgaaagcaactgcaaacttatcgtgacaaatttgggtaactagtcatcatcatcaagctaatgttgcagtctcttactaccactaaaata  15098100
                          <--------HAHB4
                          --------->YAB1
                          <---------ICU4
                         <---------YAB5
                        ------>MYB83
                        ------>MYB46(1)
                       --------->WOX13(1)                                <----------DOF2
                   <-----------GT1                                       <---------DAG2
                --------->AHL20(2)                                       <---------DOF5.7(1)
                <---------AHL25(3)                                       ------>ZmHOX2a(1)
                <---------AHL25(1)                                   --------->GATA12
            <---------YAB1--------->ATHB12                    <---------AHL12(1)
           <---------AHL25(2)                                 --------->AHL12(1)
           <---------AHL20(2)                                <---------AHL25(1)
           --------->AHL20(3)                    <---------ZAT18     <---------ARR14(2)
           --------->AHL20(2)                    --------->ZAT14     --------->ARR14(2)
->YAB1  --------->TOE2(3)<---------ATHB12        <---------ZAT14--------->RVE1(2)
---->AGL15 --------->AHL25(1)              --------->GLK1(2) --------->AHL12(3)
----------ID1 --------->WOX13(2)           <---------ARR11(2)--------->AHL25(2)
-----AGL15 <---------AHL25(1)       <---------ANAC58         <---------AHL12(2)                   --
=====MADS_MADS<---------WOX13(2)    <---------ANAC58         --------->AHL20(2)         --------->RVE1(2)
 
agaagacaaaacattaaaattaaaaccaatcatttgttttcttgagtttctgtgaactcaaaaaaaaaatcaaatcctttttgagtttcaatctctgaga  15098200
                                           <-----------GT1
             <-----------HVH21            --------->YAB1                                     <<<<<<<
             <-----------TGA1             <---------ICU4                             --------->ANAC58
            --------->YAB1     --------->YAB1--------->ZAT6                          --------->ANAC58
        --------->KAN1<--------P         <---------ATHB12<---------YAB5           ----------->HVH21
------->GLK1(2)      <-------GAMYB      --------->WOX13(2)                       <-----------HVH21
 
gtttctatgaaacaatcgtcatggggttgcacaatcttcatccaattatctctatgtctcatcatctatgtgtctctgcattcgggtcacccattcttct  15098300
                                                             <-----------HVH21
                                                            <---------ARR11(2)
                                                            <---------ARR14(2)
                                                            <----------DOF2
                                                            --------->ARR11(2)
                                                           <-------GAMYB
                                                          <---------DEAR3(2)
                                                          <---------MYB46(3)
                                                         <---------DEAR3(1)
                                                        --------->ATERF1(1)
                                                        <------NtERF2
                                                        <---------MYB52(1)
                                                       --------->LBD16
                                                       <---------ERF1
                                  ------>ZmHOX2a(2)    <---------ATERF1(1)
                                 <------ZmHOX2a(2)     <---------RAP2.3(1)
                                --------->ARR14(3)     ------>NtERF2
                                --------->AGP1        <---------RAP2.3(3)
                                <---------ARR14(2)    <---------RAP2.3(2)
                                <---------RVE1(2)     <---------DREB2C(2)               <---------DOF5.7(1)
                                --------->ARR11(2)    <---------RRTF1(2)         ------>MYB83
                                <---------AGP1        <---------RAP2.6(2)        ------>MYB46(1)
                                --------->ARR11(3)    <---------ATERF1(2)      <---------MYB111(1)
                                --------->ARR14(2)    <---------DEAR3(1)       --------->MYB46(3)
            ----------->HVH21   <---------ARR14(3)    --------->ATERF1(2)      --------->AtMYB61
           --------->At5g28300  --------->GATA12     --------->ATERF1(1)       <---------MYB46(2)
          ----------->GT1       <---------ARR11(3)   <---------ANAC58          <---------MYB55(2)
         <---------DEAR3(1)     <---------GATA12     <---------ANAC58          <---------MYB111(2)
      <---------bZIP60(1)      <---------CCA1(2)     <---------LBD16          --------->ANAC46
      --------->bZIP60(1)    <---------HSFB2a(2)    <---------ATERF1(1)     ------->GAMYB
   ----------->HVH21         --------->HSFB2a(2)  <---------MYB52(1)       --------->MYB46(3)      <
   ----------->TGA1    --------->REM1(1)         <-------GAMYB             <---------MYB55(2)      <
<<TBF1<---------O2     <---------ALFIN1     <---------At4g35610       <---------DOF5.7(1)       <---
 
tctctagtgacgacggtgacaatgccacacctctagatcttcatttcatctccgttgccggcggtttcaggcctcttaaccaccaaactcgccttctccg  15098400
                              <------MYB83
                              <------MYB46(1)
                    <---------ANAC58
                    <---------ANAC58
                    --------->ANAC55(2)                                                        <----
                   <---------TOE2(2)                                                           -----
            <---------ATHB12<--------P                <---------AHL20(2)                       <----
      <-----------GT1     <---------MYB46(3)          <---------AHL12(1)                 <---------TOE1(3)
   --------->MYB52(2)    <---------AtMYB61          --------->WOX13(2)                   <---------TOE2(3)
------MYB46(1)     <---------TOE1(2)     --------->DAG2 <-----------GT1                 ---------->DOF2
------MYB83--------->GATA12<-------GAMYB--------->AHL12(1)    <---------YAB5<---------MYB46(3)------
------MYB52(1)    <-----------GT1   ----------->GT1 <---------WOX13(2)  --------->ATHB12<---------DOF5.7(2)
 
attggtttgtttccaatcttcttacgttttggttggaacatgaaaaattggtttcaatttatctagttatcgaattcattggtttcatggttaaagtttg  15098500
                             --------->YAB1
                            <-------TEIL
                          --------->ARR14(2)
                          <---------ARR14(2)
                         <------ZmHOX2a(1)
                         ==================================HOX2a_HOX2a
                       --------->LBD16
                      <---------LBD16                <-------GAMYB
                      <-----------RAV1(2)           ------>ZmHOX2a(2)
--MYB83              <---------LBD16                <---------MYB46(3)      <---------ARR11(2)
------>GT1           --------->LBD16     <---------ARR11(2)              <---------HSFB2a(2)
--MYB46(1)      <---------ANAC58<---------ICU4     <---------YAB5 ---------->DOF2
--->MYB59       <---------ANAC58--------->ATHB51  <---------RVE1(2)      <---------------------WRI1
 
gttatttatagtatttctagcttccccaggattcataatttgtgtttctgtttgatcgttgaagatggagaaagttgcagaaacttacaaggccaaattt  15098600
<- Previous    Next ->

AGI:  At4g30993.1   
Description:  similar to hypothetical protein [Vitis vinifera] (GB:CAN67945.1); contains domain Metallo-dependent phosphatases (SSF56300)
Range:  from: 15098073    to: 15100564    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version