AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                              <---------AHL25(3)
                                                                              --------->AHL12(1)
                                                                              --------->AHL20(2)
                                                                              <---------AHL25(1)
                                                                              --------->AHL20(1)
                                                                             --------->AHL25(3)
                                                                           --------->AHL12(2)
                                                                           <---------AHL12(2)
                                                                          <---------AHL20(2)
                                                                          <---------AHL12(3)
                                                                          --------->AHL12(3)
                                                                          --------->AHL25(1)
                                                                          <---------AHL25(2)
                                                                          --------->AHL25(2)
                                                                          --------->AHL20(2)
                                                                          <---------AHL25(3)
                                                                          --------->AHL25(3)
                                                                          <---------AHL25(1)
                                                                         <---------AHL20(2)
                                                                         --------->AHL12(3)
                                                                         --------->AHL20(2)
                                                                         <---------AHL12(3)
                                                                         <---------AHL12(1)
                                                                         --------->AHL25(1)
                                                                         --------->AHL25(3)
                                                                         <---------AHL25(3)
                                                                  --------->TOE1(3)
                                                               ------>NtERF2 <---------AHL25(2)
                                                              --------->DEAR3(1)
                                                             --------->SPL7(1)<---------AHL12(1)
                                                             --------->ATERF1(1)
                                                            ------>NtERF2<---------AHL25(2)
                                                            <---------ATERF1(1)
                                                           --------->At1g77200<---------AHL25(2)
                                                           --------->DREB2C(2)<---------AHL20(2)
                                       <---------GATA12    --------->RAP2.3(3)--------->AHL25(2)
                                       --------->GLK1(2)   ----------->HVH21 --------->AHL12(3)
                                       --------->ARR14(2)  --------->DEAR3(1)<---------AHL12(3)
                                       --------->RVE1(2)  --------->ERF1 --------->AHL12(1)
                                       <---------ARR14(2) --------->ORA47(2) --------->AHL12(1)
                               --------->ARR11(2)         --------->RAP2.3(1)<---------AHL12(1)
                 --------->AtLEC2     --------->GLK1(1)   --------->DEAR3(2)--------->AHL12(2)
              <---------ATHB12 <---------ARR14(2)        ------>NtERF2 --------->WOX13(2)
             ------>MYB46(1)   <---------ARR11(2)       --------->DEAR3(1)<---------AHL20(1)
             ------>MYB83      --------->ARR14(2)       ------->GAMYB--------->AHL20(2)
    <---------GATA12       <---------At4g35610         --------->MYB46(3)<---------AHL25(1)
    --------->GATA12       --------->At4g35610         --------->DEAR3(2)--------->AHL25(2)
    <---------RVE1(2)      --------->ZAT2           <---------MYB52(2) <---------WOX13(2)
----------DOF2--------->MYB46(3)  ----------->GT1 --------->ZAT6  --------->TOE2(3)
--------GT1  -------->P    <---------ZAT2 <-----------RAV1(2)<------NtERF2--------->AHL20(1)       <
 
aactttggatttagccaaccatgcattctcagcagaaccgaaaatccaggttgtcactaccgccgacgaccttaaattaaattttttgacaatagctgtt  14982000
                                                                                 --------->YAB1
                                                                                <-------TEIL
                                                                            <---------YAB5
                                                                            <---------YAB1
                                                                       --------->YAB5           <---
                                                                       <--------ATHB1           ----
                                  <---------LBD16                      --------->ATHB12      <------
                        ------>ZmHOX2a(2)                              -------->HAHB4     --------->ANAC46
                        =================================HOX2a_HOX2a   --------->YAB1     --------->ANAC58
                      --------->GATA12                                 <---------ICU4     --------->ANAC58
                      --------->ARR11(2)                              <---------ATHB12  <---------ALFIN1
                      <---------ARR11(2)                              <---------YAB5  --------->ANAC58
                      --------->ARR14(2)                              <---------YAB1  --------->ANAC58
             --------->YAB1   <----------DOF2                         --------->ICU4  <---------ANAC55(2)
     <XXXXXXXXXXXXXXXXXXXXMIR864-5P--------->LBD16                <---------MYB52(2)  --------->ANAC55(2)
---------RVE1(2)     <------ZmHOX2a(1)            ------>ZmHOX2a(1)  <---------TOE2(3)--------->ANAC46
 
tcgattttcaagttgatcatatcaggatcgatactttcagggattgagtagtcctcaatggcccatacaactaatgattgtgattcatcacgcactccac  14982100
                                           <------ZmHOX2a(2)
                                          --------->ARR11(3)
                                          <---------ARR11(3)
                                          --------->GATA12
                                 ------>ZmHOX2a(2)
                                <------ZmHOX2a(2)                       ------>MYB46(1)
                               --------->ARR11(3)                       ------>MYB83
                               <---------AGP1                         <---------MYB111(1)
                               --------->AGP1                <---------AHL12(2)
                               --------->GATA12             <---------AHL12(3)
                               <---------ARR11(3)           <---------AHL20(3)
                    --------->CCA1(2)     --------->RVE1(2) --------->AHL12(3)
           --------->ANAC58    <---------GATA12             --------->AHL20(3)
           <---------ANAC55(2) <---------RVE1(2)          --------->AHL12(3)
     <---------TOE2(3)   XXXXXXXXXXXXXXXXXXXX>MIR865-5P   --------->AHL20(3)                --------
 <---------ZAT2    --------->ARR11(3)     <---------GATA12--------->AHL20(2)               <--------
 <---------At4g35610--------->GLK1(1) --------->YAB1      --------->AHL25(1)             <---------bZIP60(1)
------GATA12       <---------ARR11(3)<---------ATHB12     <---------AHL20(2)       --------->DOF5.7(1)
----->GATA12   ---------->DOF2 --------->RVE1(2)--------->YAB1 --------->AHL20(1)---------->DOF2
---ALFIN1  --------->ANAC58  --------->MYB59   <------ZmHOX2a(2)      <---------MYB111(2)--------->bZIP60(1)
 
atccagctaatgttacgaaaaagatatcaagttagatctaatcaagatcgatcatagacatataaatatactaccaacttcacagaaagatgatatcata  14982200
                      --------->At4g35610
                    --------->YAB1
                   <---------ATHB12
             <---------HSFC1(1)
             --------->HSFB2a(2)
             <---------HSFB2a(2)
             --------->HSFC1(1)
        <---------WOX13(2)
        --------->WOX13(2)                      --------->RAP2.6(2)
       <---------AHL20(2)                       ------>NtERF2
       <---------AHL25(3)                      <---------ATERF1(2)
       --------->AHL12(3)                      --------->ATERF1(2)
       <---------AHL12(2)                     --------->ATERF1(1)
       --------->AHL25(2)                     --------->RAP2.6(3)
       <---------AHL25(1)                     <------NtERF2
      --------->AHL12(3)                     <---------ATERF1(1)
      <---------AHL20(2)                    <---------DEAR3(1)
      <---------AHL20(1)                   <---------ANAC58
      --------->AHL20(2)                   <---------ANAC46
      --------->AHL25(1)                 <---------MYB46(3)
      <---------AHL25(3)            --------->HSFB2a(2)   ----------->ARR10
      --------->AHL12(1)            <---------HSFB2a(2)   --------->ANAC58
      <---------AHL12(1)        <---------GLK1(1)         --------->ANAC58
      --------->AHL25(3)        --------->GLK1(1)    --------->DOF5.7(1)                       -----
      <---------AHL25(2)       --------->ARR14(2)<------NtERF2                            <---------ANAC58
      <---------AHL25(1)       <---------GATA12<---------DEAR3(1)                         <---------ANAC58
   --------->YAB5--------->GLK1(1) <---------LBD16 ---------->DOF2                    --------->ARR11(3)
->YAB1--------->AHL25(2)       --------->GATA12<---------ANAC46                     <---------YAB5 <
-YAB1--------->AHL25(3)<---------DOF5.7(1) <---------ANAC58  --------->GLK1(2) <---------ANAC46<----
 
aacaaacaattaatttcgagaaatcatcttactggatttcccgatggctggcggcaaagggaagaaactggacatggtttcgacgtagagatttcgttct  14982300
                                                              <---------ANAC46
                                                              <---------ANAC58
                                                              <---------ANAC58
                                                            <---------MYB46(3)
                   <---------At4g35610                      ------>NtERF2
                   --------->At4g35610                      --------->MYB55(2)
                 <---------ANAC46                          <---------DEAR3(1)
                <------NtERF2                              *TSS
               ------>NtERF2                               --------->ALFIN1
               <---------MYB46(3)                   ---------->DOF2
               --------->MYB55(2)                  --------->YAB1
             <---------MYB52(1)                   <---------YAB1
  --------->AHL25(1)                           --------->AHL20(2)
  --------->AHL20(3)                           --------->AHL20(3)
  <---------AHL20(2)                           --------->AHL25(2)
  --------->AHL20(2)                           <---------AHL20(3)
  --------->AHL25(2)                           --------->AHL25(3)
  <---------AHL25(2)                           <---------AHL25(2)
  <---------AHL20(3)                           <---------AHL20(2)
  <---------AHL25(1)         <----------DOF2   --------->AHL25(1)   <---------At4g35610
---->HSFB2a(2)<---------DEAR3(1)               <---------AHL25(1)   --------->At4g35610
---------RVE1(2)<---------At4g35610         <---------RVE1(2)<------NtERF2           <---------WOX13(2)
-----HSFB2a(2)--------->ALFIN1      <---------WOX13(2)   <---------MYB46(3)   <----------DOF2
 
gggattttattgtaccggtggctgatgagggactttgtgaatttagggattttattatagcggtggctggctgatgagcgactttgtgaatttagggtct  14982400
                                                                                                 ---
                                                                                              ------
            ------>NtERF2                                                                  ------>ZmHOX2a(1)
            <------NtERF2                                                                ------>ZmHOX2a(2)
          <---------ANAC58                                                             <---------ARR14(2)
          <---------ANAC46                                                             --------->ARR14(2)
          <---------ANAC58                                                             <---------GATA12
         <---------LBD16                                                               --------->GATA12
         <<<<<<<<<E2Fd                                                                 --------->ARR11(3)
         <<<<<<<<<E2Fc                  <---------TOE2(2)                            ----------->ARR10
    <---------WOX13(2)                  <---------TOE1(2)            <-----------RAV1(2)<------ZmHOX2a(2)
    --------->WOX13(2)            <----------DOF2      --------->ANAC58          <---------WOX13(2)
 ------------>CBF                <---------DOF5.7(1)   --------->ANAC58   <-------TEIL <---------ARR11(3)
 
gtctgtcaatttggcgggctgtccatgggccaagcgtctttcgcaggtttttgggcccaagcctactaagtgccaggtccagcccattaagatcctatat  14982500
                                                                  --------->DEAR3(1)
                                                                --------->At4g35610
                                                                --------->LBD16
                                                                <---------At4g35610
                                                              <---------LBD16
                        ------>MYB46(1)                    <---------ZAT14
                      <---------ALFIN1                     --------->At4g35610
                      ------->GAMYB                        --------->ZAT18           --------->LBD16
                   <-----------GT1                         <---------At4g35610       <---------At4g35610
        ------------>CBF------>MYB83                     --------->ZAT18             --------->At4g35610
      <---------ZAT18<---------MYB55(2)                  <---------ZAT18         <---------ARR14(2)
      --------->ZAT18--------->MYB46(3)                ------->MYC3              --------->ARR14(2)
  --------->CCA1(2)--------->ARR11(2)                  <-------MYC3------>NtERF2 --------->ARR11(2)
------->DOF2 --------->YAB1  <---------WOX13(2)  --------->YAB1--------->ANAC46  <---------ARR11(2)
--->RVE1(2)<------------CBF*TSS     ---------->DOF2 --------------------->WRI1  <---------KAN1
 
caaagatagggcacaattgtagtaaccaccctaatttcacaaagtctctcaataaccatgtgtgctccgcagccctccaacgagtttccgctgatttttc  14982600
                                <---------AHL20(2)
                    --------->GLK1(1)
                    <---------KAN1
                    <------ZmHOX2a(2)
                    <---------GLK1(1)
                   <---------AGP1
                   --------->ARR14(2)       <---------YAB5
                   <---------ARR14(2)     -------->ATHB1
                   <---------GATA12       --------->YAB1
                   <---------ARR11(3)     <--------ATHB1
                   --------->ARR11(3)     --------->ATHB51
                   --------->ARR11(2)     <---------ICU4         <---------ANAC46
                   <---------ARR11(2)    <---------ATHB51        <------MYB83
                   --------->GATA12      <---------ATHB12        <------MYB46(1)
                  <---------CCA1(2)      --------->ICU4         --------->MYB55(2)
         ------>ZmHOX2a(2)      <---------AHL25(1)              <---------MYB46(3)
        --------->CCA1(2)       <---------AHL25(3)             <---------MYB55(1)
        <------ZmHOX2a(2)      --------->AHL20(2)             <---------MYB52(1)
       --------->ARR14(2)     --------->AHL12(2)             <-------GAMYB
       --------->RVE1(2)    <---------AHL12(3)       <---------ICU4
       --------->ARR11(3)   <---------AHL12(1)       --------->ATHB12
       <---------GATA12     --------->AHL12(1)       -------->ATHB1
       --------->GATA12     --------->AHL12(3)       --------->YAB5
       --------->AGP1       <---------AHL20(2)       --------->YAB1
       <---------ARR14(2)  <---------AHL20(1)       <---------ATHB12                             ---
       <---------AGP1------>ZmHOX2a(2)   <---------YAB1     <---------MYB46(3)    ------->MYC3 <----
       <---------ARR11(3)  --------->AHL20(1)       --------->ICU4          --------->ANAC58   -----
       <---------RVE1(2)   <---------ARR11(3)       <---------YAB1          --------->ANAC58   <----
     ----------->ARR10     --------->AHL25(3)    <---------AHL20(2)     ----------->GT1       <-----
 ----------->GT1  <---------ARR14(1)--------->YAB1  <---------YAB5 <--------P     <-------MYC3------
 
gcaagggtaagatctgtaatcggatctctatatatttaatcgcaataattgtttaatcattgtccgttgggtagatggtaagacatgtgtgttttgggat  14982700
                                              <------NtERF2
                                             --------->LBD16
                                            <---------ANAC46
                                            <---------DEAR3(1)
                                      <---------ARR14(2)
                                      --------->GATA12
                               ================HOX2a_HOX2a
                       ------>ZmHOX2a(2)   <---------LBD16
                       ===============HOX2a_HOX2a  <---------YAB5
                      --------->GLK1(1) <---------LBD16
                     <---------ARR11(3) ==========================HOX2a_HOX2a
                     <---------GATA12 --------->ARR11(2)
                     --------->GATA12 <---------GATA12
                     --------->ARR11(3) ------>ZmHOX2a(2)
    <---------KAN1   <---------ARR14(2)===========================HOX2a_HOX2a
  ============================HOX2a_HOX2a --------->LBD16                                        <--
  <------ZmHOX2a(1)  --------->ARR14(2)<------ZmHOX2a(2)                                    <------NtERF2
  --------->YAB5 --------->At4g35610  <---------ARR11(2)                               <---------DEAR3(1)
------>ALFIN1    <---------At4g35610  <---------RVE1(2)---------->DOF2               --------->LBD16
-----KAN1        <---------ZAT2------>ZmHOX2a(1)  --------->GLK1(2)      <---------YAB1<---------AtMYB61
---->ALFIN1      --------->ZAT2===============HOX2a_HOX2a    <---------KAN1         <---------ANAC46
-----ANAC46      ----------->RAV1(2)  --------->ARR14(2)   <------ZmHOX2a(1)       <---------LBD16
----RVE1(2)    <-----------RAV1(2) <---------TOE1(2)--------->YAB1       <---------TOE2(3)--------->ALFIN1
--->GATA12 --------->RVE1(2)  --------------------->WRI1 <---------TOE2(3)        <---------ANAC46--
 
gtggaggattacccaatcccagctgatctccatcctcgttcgatccggcggagaatcgtaaaggatgtgaagaaatatggttgtgatgcggaggtgtcga  14982800
             --------->YAB1                              --------->HSFB2a(2)
             --------->YAB5                            --------->ZAT2
             -------->HAHB4                            --------->At4g35610
            --------->ICU4                             <---------ZAT2
            <---------YAB1                            <---------MYB46(3)
            <---------ATHB12                         <---------DEAR3(1)
      <---------YAB1                                <---------At4g35610
    --------->KAN1                           --------->WOX13(2)                             --------
  <---------ANAC58                           <---------WOX13(2)                  --------->MYB46(3)
  <---------ANAC58                        <------NtERF2<---------At4g35610      --------->ANAC58
<---------YAB1 <---------YAB1           <---------ANAC46<---------ANAC46        --------->ANAC46
-----TEIL  <---------TOE2(3)    --------->ICU4      --------->At4g35610         --------->ANAC58
------->KAN1<---------YAB5  --------->At5g28300   <---------RAP2.6(2)     <---------ZAT6    <-------
 
ttcatgcttatgctaatgataatacggtctcggtaacaatgaggcgtcaattttcggctgctggaatcaaattggaagtgttcacccaaggtgagaattc  14982900
<- Previous    Next ->

AGI:  At4g30750.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G30730.1)
Range:  from: 14981192    to: 14982360    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At4g30760.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G62050.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO40196.1); contains InterPro domain Protein of unknown function DUF537 (InterPro:IPR007491)
Range:  from: 14982528    to: 14983427    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version