AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                   <---------AHL20(2)
                   --------->AHL20(2)
                   <---------AHL25(1)
                 --------->WOX13(2)                      <---------DOF5.7(1)
                 <---------WOX13(2)                     <---------DOF5.7(1)
     --------->DEAR3(1)                                 <---------DAG2                         <<<<<
    --------->ANAC58                                    --------->TOE2(3)                   <-------
  <---------ALFIN1 <---------AHL25(3)             --------->ANAC46                          <-------
----->KAN1  <-----------GT1                       --------->ANAC58     <---------YAB1     <---------WOX13(2)
-----YAB5<---------KAN1    <---------KAN1         --------->ANAC58   <----------DOF2 <-----------GT1
-GT1--------->ANAC58 --------->MYB52(1)      <-------TEIL<----------DOF2         <---------DOF5.7(1)
 
cattcgcaccgcatgttacaaattaaacggacatcgaaaactactacatacatactcaaccttttttataaacttttatagccattttttgccaatttat  13608900
                                                                       <---------YAB1
                                       <---------YAB1                  <---------WOX13(2)
       --------->ZAT6                  <---------TOE2(3)         --------->LBD16
  --------->ANAC55(2)                  <---------YAB5           --------->O2
  <---------ANAC55(2)                 <-----------GT1           <---------ANAC46
  ----------->GT1                  <---------AHL12(2)       --------->ZAT18
 <---------TOE2(3)              --------->AHL12(2)        <---------ZAT18
<<<<GATA-1                      --------->AHL12(3)       <---------ANAC46
--AHL12(1)                  --------->ANAC55(2)          <---------ANAC58                  ---------
--AHL20(2)                --------->AHL20(2)             <---------ANAC58      <---------YAB5
 
ctataacgtaatactatgcattccctcatttacatattttttaacattgttcaaagggttgtgtgccccgtgttaatatagagtcattttctaacatcta  13609000
                                                                               <---------WOX13(1)
                                                                              --------->WOX13(2)
                                                 <---------AHL20(2)           <---------WOX13(2)
                                                 --------->AHL20(2)          --------->ATHB12
                                                 <---------AHL25(3)         --------->AHL20(2)
                                               --------->WOX13(2)     --------->ANAC58
                      --------->KAN1           <---------WOX13(2)     --------->ANAC46
                  --------->YAB1              ------>MYB83            --------->ANAC58  ------>MYB46(1)
         --------->At4g35610                  ------>MYB46(1)       --------->KAN1      ------>MYB83
>GATA12  <---------At4g35610          <-----------GT1   <---------WOX13(1)  <---------AHL20(2)
 
caattcagattaagctcccaaacatatgttccaattgcaatataccaccaaattaaaagattgactctcacataccccattaattgaaaccaaatgaaca  13609100
                          --------->TGA2(2)
                         <-----------TGA1
                         <-----------HVH21
                        <---------TGA1a
                        --------->O2
                        <---------bZIP60(1)
                        --------->TGA1a
                        --------->bZIP60(2)                                   ----------------------
                        --------->bZIP60(1)                                 --------->ALFIN1
                        --------->ANAC58                                    --------->SPL7(1)
                        --------->ANAC58                                   <------NtERF2
                        --------->ANAC46                                  --------->LBD16
                        <---------ANAC55(2)                             <---------LBD16         <---
                        --------->ANAC55(1)                         ----------->HVH21           ====
                        <---------O2                                --------->ARR14(2)          <---
                        --------->ANAC55(2)       <---------ANAC55(2)  <---------ANAC46         ----
           <---------RVE1(1)                      --------->ANAC55(1) --------->ATERF1(1)       ----
           <---------CCA1(1)                      --------->ANAC46  --------->ARR11(2)          <---
          --------->ARR11(3)                      --------->ANAC55(2)--------->KAN1 --------->ALFIN1
          <---------AHL20(1)                 ----------->HVH21      <---------ARR11(2) --------->KAN1
          --------->AHL20(1)        <---------ARR11(3)              <---------ARR14(2)<-------------
          <---------ARR11(3)        --------->RVE1(2)              <------NtERF2   <---------MYB52(1)
          <---------RVE1(2)         --------->ARR11(3)            --------->LBD16<---------MYB46(3)
    --------->YAB1  <-----------HVH21 ------>ZmHOX2a(2)         <---------LBD16  <---------DEAR3(1)<
   <-------TEIL <---------TOE2(3)   --------->GATA12     --------->AtLEC2--------->ALFIN1   <-------
 
aaaacgttcataagatattaagatgtcacgtcagaacatgatctacaaatgacacataacatgcagacgcggagacgcggagggccggtgttgttcgtca  13609200
                                        <------ZmHOX2a(2)
                                       <---------ARR11(3)
                                       --------->ARR11(3)                                 --------->ANAC58
                                       <-----------ARR10            <-------TEIL          --------->ANAC58
                                       <---------ARR14(3)         <-------MYC2            --------->AtLEC2
                                       <---------GATA12           ------->MYC3       ------>ZmHOX2a(2)
                                       --------->GATA12           <-------MYC3   ----------->HVH21
                                       --------->ARR14(3)         ------->MYC2  ------->MYC3
                                       --------->ARR14(2)        --------->KAN1 ------->MYC2
                               ------->GAMYB                --------->TGA1a     <-------MYC2
                              <---------MYB111(2)           --------->ANAC58    <-------MYC3
 <-----------GT1         --------->ANAC46------>ZmHOX2a(2)  --------->O2       --------->ANAC58
->TaNAC69(2)       ------>MYB46(1)--------->TOE1(2)         ----------->HVH21  <---------O2
------O2           ------>MYB83=======================================MYC_MYB  --------->O2---------
=======================================MYC_MYB              --------->bZIP60(2)--------->ANAC46
------ANAC55(2)  <---------MYB111(1)   <---------RVE1(2)    ========================================
----->ANAC55(2)  <---------MYB59  --------->TOE2(3)         --------->ANAC58   <---------ANAC55(2)
----->O2        <---------ANAC55(2)    <---------ARR14(2)   --------->ANAC46   --------->TGA1a
------TGA1a     --------->ANAC46  --------->TOE2(2)       --------->ANAC46     --------->ANAC58
--AtSPL3        --------->ANAC55(1)    --------->AGP1   <---------ALFIN1       <---------TGA1a
-----------HVH21--------->ANAC55(2)  ----------->ARR10--------->ANAC58         =====================
----HVH21     <---------ALFIN1--------->MYB46(3)      --------->ANAC58         --------->ANAC55(2) <
 
cttgtcactctcttccaacacctaatccagacaacaacctaagatcttcactctcgcacacacacgacacatgcattcttacacgtgatcgccatgcaat  13609300
                                    --------->ZAT14
                             --------->ZAT14
<----------DOF2 <---------MYB52(2) <----------DOF2      <---------ICU4
--->CBF    ----------->TBP   <---------ZAT14  --------->AtMYB61
===========bZIP_DOF          <---------ZAT18  *TSS      --------->YAB1                         -----
===========bZIP_DOF        --------->ANAC46 >>>>>>>>>>MYB80       --------->YAB5              ------
---------DOF5.7(1)  --------->ZAT6<---------DOF5.7(1)  <---------YAB5<---------KAN1     ----------->GT1
 
ctcctttctcacctataaaactaactcttcacttcactctttactcaaaccaaaactcatcatcacaaacgagtaagaatacaaacacaaatagcaaaaa  13609400
                                                                           --------->ZAT14         -
                                                                          <-----------RAV1(1)     <-
                      --------->At4g35610              ------>MYB46(1)--------->ZAT18             --
         --------->ARR11(3)                            ------>MYB83   <---------ZAT14             --
         <---------ARR11(3)  <----------DOF2         --------->AtMYB61<---------ZAT18             --
       --------->ANAC58 --------->LBD16              --------->DEAR3(1)<---------ALFIN1           --
       --------->ANAC58--------->ANAC46             --------->MYB46(3)--------->ZAT14             --
   --------->ANAC58   <---------LBD16            ------>ZmHOX2a(1)  --------->ANAC46            <---
   --------->ANAC58   --------->ZAT18         ------>ZmHOX2a(1)    -------->P                  -----
---->DOF5.7(1)      <---------DEAR3(1)  --------->At4g35610        <---------At5g28300       -------
--->AHL20(2)    ------>ZmHOX2a(1)       <---------At4g35610      --------->MYB46(3)          <------
 
aatggcaaacaagctcttcctcgtctgcgcaactttcgccctctgcttcctcctcaccaacgcttccatctaccgcactgttgtcgagttcgacgaagat  13609500
        ------->GAMYB
      -------->P
    --------->AtMYB61
    --------->MYB46(3)
   <---------At4g35610
   --------->At4g35610
   <------NtERF2
   --------->ZAT2
   <---------ZAT2
  --------->ANAC58
  ------>NtERF2
  --------->ANAC46
  --------->ANAC58
----->NtERF2
--------bZIP60(1)                                               <---------ARR11(3)
------->ANAC58                                                  --------->ARR11(3)
------->bZIP60(1)                                          --------->TOE1(2)
------->ANAC46                                            --------->ANAC58
------->ANAC58                                       --------->ANAC46
------->TGA2(1)                                    --------->YAB1      <---------HSFB2a(2)
------TGA2(2)       --------->ANAC58              <---------ATHB12     --------->HSFB2a(2)
------>TGA1         --------->ANAC46          <---------At4g35610 <---------ANAC58
-->At4g35610        --------->ANAC58  <------ZmHOX2a(1)   --------->ANAC58             --------->ANAC58
---At4g35610   <---------PCF2 <-----------HVH21 --------->WOX13(1)<---------ANAC58     --------->ANAC58
 
gacgccagcaaccccatgggcccaagacagaaatgtcagaaggagtttcagcaatcacagcacctaagagcttgccagaaattgatgcgcatgcaaatga  13609600
                                                                                                ----
                                                                                                <---
                                                                                                <---
               --------->PCF5                                                                  -----
               --------->TCP16(1)                                                       --------->AGP1
               --------->PCF2                                                           --------->RVE1(2)
               <---------PCF2                                                           <---------ARR14(3)
             <---------MYB46(3)                                                         <---------ARR11(2)
            <---------AtMYB61                                                           <---------GLK1(2)
            --------->ALFIN1                                                            <---------ARR11(3)
          <---------MYB46(3)                                                            --------->ARR14(2)
         --------->ALFIN1                                                               --------->ARR11(2)
         <---------DEAR3(1)                                              <-----------RAV1(2)------>ZmHOX2a(1)
         <---------AtMYB61                                              <------NtERF2   <---------ARR14(2)
      --------->ALFIN1                                                 <------NtERF2    --------->ARR11(3)
      <---------AtMYB61                         --------->ANAC58  --------->ANAC58      <---------GATA12
    <---------ANAC46                  --------->GATA12        --------->ANAC46          --------->GATA12
    <---------ANAC58                  <---------RVE1(2)<---------HSFB2a(2) --------->ZAT2 ------>ZmHOX2a(2)
    <---------ANAC58                  <---------GATA12 --------->HSFB2a(2) <---------ZAT2<------ZmHOX2a(2)
--------->ANAC58            --------->YAB5      --------->ANAC58  --------->ANAC58      --------->ARR14(3)
--------->ANAC58        ----------->HVH21       --------->ANAC46 ---------->DOF2      ----------->ARR10
 
ggcaaggccgtggtggtggtccctccctcgacgatgagttcgatttggaagacgacatcgagaacccacaaggcccccagcagggacaccagatcctcca  13609700
         <---------ZAT18                                              --------->DOF5.7(2)          <
       <---------At4g35610                                            <---------MYB52(1)          <-
    <---------ZAT14                                                  <-------GAMYB                --
    <---------At4g35610                                             <---------MYB46(3)        <-----
    --------->At4g35610                                  --------->At4g35610                  ------
 --------->At4g35610                                     <---------At4g35610             <---------ANAC55(2)
 --------->ZAT14                                         <---------ZAT2                  --------->ANAC55(1)
--------->ALFIN1       --------->DOF5.7(1)               --------->ZAT2                  --------->ANAC46
----->ZAT2 --------->ZAT2                               --------->ANAC58                 --------->ANAC58
------ZAT2 <---------ZAT2                    ------>NtERF2  ------>NtERF2                --------->ANAC58
------At4g35610      <------ZmHOX2a(1)      <---------ALFIN1<-----------HVH21         <---------REM1(2)
------>RAV1(1)    <-----------RAV1(2)    --------->PCF2 --------->ANAC58       --------->LBD16------
 
gcagtgctgcagcgagcttcgccaggaagagccagtttgtgtttgccccaccttgagacaagctgccagggccgttagcctccagggacaacacggacca  13609800
<- Previous    Next ->

AGI:  At4g27150.1   
Description:  2S seed storage protein 2 / 2S albumin storage protein / NWMU2-2S albumin 2. Identical to 2S seed storage protein 2 precursor (AT2S2) [Arabidopsis Thaliana] (GB:P15458); similar to AT2S3, lipid binding / nutrient reservoir [Arabidopsis thaliana] (TAIR:AT4G27160.1); similar to Napin-B precursor (1.7S seed storage protein) [Contains: Napin-B small chain; Napin-B large chain] (GB:P27740); contains InterPro domain Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612); contains InterPro domain Bifunctional trypsin/alpha-amylase inhibitor (InterPro:IPR013771); contains InterPro domain Napin/ Bra allergen; (
Range:  from: 13609347    to: 13610081    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version