AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                            --------->ZAT6
                          <-----------GT1
                         <---------ICU4
                       --------->AHL12(2)
                       <---------AHL12(2)
                       <---------WOX13(2)
                       --------->WOX13(2)
           <---------AHL25(1)
           --------->AHL25(2)
           <---------AHL20(3)
           --------->AHL20(3)
           <---------ARR11(3)
           <---------AHL20(2)
           <---------AHL25(2)
           --------->ARR11(3)
           --------->AHL20(1)
           <---------AHL12(1)
           --------->AHL20(2)                                                                -------
           --------->AHL12(1)                                                               --------
           <---------AHL25(3)                                                            --------->DOF5.7(1)
      --------->AHL20(2)<---------YAB5                                                  --------->AHL25(2)
    <----------DOF2  --------->AHL25(3)                                                 <---------AHL12(3)
   <---------DAG2    --------->AHL20(2)                 ------->TEIL                    --------->AHL20(2)
   <---------DOF5.7(1)--------->YAB1                ------->MYC3                        <---------AHL25(1)
--------->REM1(1)    --------->AHL25(1)      --------->KAN1                      >>>>>>>>>GATA-1   <
<---------ALFIN1     --------->ICU4     <----------ID1<-------TEIL             ----------->GT1    <-
-->KAN1    <---------AHL20(1)      ---------->DOF2  <-------MYC3         ---------->DOF2<---------AHL25(2)
 
tctacaccttttaatatattggcattaattatctctaccaaagaagacaaattcacatgcatttacacaaacttgctaaagatagataaaaaaaaatgat  13527400
                                              <---------YAB5
                                        <---------ARR11(3)
                                        --------->RVE1(2)
                                   <---------AHL20(2)
                                   <---------AHL12(3)
                                   <---------AHL25(1)
                                   --------->AHL20(2)                --------->ANAC58
        ----------->GT1            --------->AHL12(3)                --------->ANAC58      <--------
       --------->DAG2              --------->AHL20(3)          ---------->DOF2             <--------
-->ATHB12                          --------->AHL25(1)        --------->ANAC58              <--------
->ICU4---------->DOF2              <---------AHL20(3)        --------->ANAC58          --------->ZAT18
---------ANAC46                 --------->GATA12       <----------DOF2                 <---------ZAT18
--------TOE2(3)      <---------AHL12(2)<---------CCA1(2)     --------->ANAC46   --------->ANAC46 <--
 
ttacgtagataaagcaaaaaaaaaaaaaaacttgagatttatatatctaatgagttggctttatacgaaagtaagccaaatatactcaaggggacttttt  13527500
                                                          <---------ARR11(2)
                                                          <---------ARR11(3)
                                                          --------->ARR14(2)
                                                          <---------ARR14(2)
                                                          --------->ARR11(2)
                                                          --------->ARR11(3)
                                                         <---------GLK1(1)
                                                         --------->GLK1(1)               <---------KAN1
                                                         <---------KAN1                 <---------ARR14(2)
                                                         <----------TaMYB80             <---------ARR11(2)
                                                         <---------CCA1(2)           <---------ANAC58
                                                         --------->KAN1              <---------ANAC46
                                                        --------->ARR11(2)           <---------ANAC58
                                                        --------->ARR14(2)         <---------ANAC46
                                                        <---------ARR14(2)      --------->ARR14(2)
                                                     ----------->GT1            <---------ARR14(2)
                                                     <---------ANAC46           --------->ARR11(2)--
                                                   <---------ARR11(3)   <-----------TBP --------->ARR14(2)
--DOF2                             <---------DOF5.7(1)  ---------->TaMYB80<---------AHL20(2)<-------
-DOF5.7(1)                <---------KAN1          --------->RVE1(1)   <---------AHL20(2)<-----------ARR10
-DAG2  --------->LBD16  <---------ANAC58     --------->TOE2(3)       --------->AHL25(3)<---------CCA1(2)
---------RAV1(1)        <---------ANAC58   --------->RVE1(2)  ------>ZmHOX2a(1) <---------ARR11(2)<-
 
gtgttgtctccagagaaacaaactctggcatgtctctctcttctctaatctaaatatcgtatatcctctgtttttatttataggttctgcgtatattacc  13527600
                                                                                               <----
                                                                                              <-----
                                                                                              ------
                  <-----------GT1                                                             ------
                <---------DOF5.7(1)                                                     --------->At5g28300
           ---------->ID1                                                         <-----------RAV1(2)
    <---------ARR11(3)                                                            ---------->CDC5
    --------->GATA12                                                              ==================
    --------->ARR11(3)                                        --------->DOF5.7(1) <---------LBD16
--------->GT1  <---------DOF5.7(1)       <-----------HVH21  ---------->DOF2   --------->ARR11(3)
----GT1 --------------->AtSPL8     <---------YAB5 <------ZmHOX2a(1)           <---------ARR11(3)
--------ZAT6   <----------DOF2    <-----------HVH21   ----------->GT1 <---------KAN1   ----------->GT1
 
agagttaaatctttgttccttttaccttcttgctccttgtcatttgtcagagaggagaggtaacaaagaccgagtatggaagaactcagggggtgaatat  13527700
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                          --------->ANAC58                    ------
             <---------ARR11(3)                           --------->ANAC58                  <-------
             --------->ARR14(2)                          --------->SPL7(1)                  --------
             --------->RVE1(2)                         ----------->HVH21         <---------ZAT14 <--
       --------->ARR11(2)                             --------->LBD16          <---------SPL7(1) <--
       <---------ARR11(2)                            --------->LBD16        ------>ZmHOX2a(2)-------
     <------MYB46(1)                            <---------ATHB12            <------------------SPL14
     <------MYB83                               --------->MYB46(3)          ========================
     <---------MYB46(3)                        ------>MYB46(1)            --------->ARR11(3)<-------
     <---------DEAR3(2)                        ------>MYB83              --------->YAB1<------NtERF2
 <-----------RAV1(1)                        ------------>CBF   --------->ALFIN1<---------ZAT14------
-----YAB1    --------->GATA12        <---------ANAC58<---------LBD16    <---------YAB5--------->MYB55(2)
----ARR11(3) <---------ARR11(1)      <---------ANAC58--------->ANAC46   --------->ICU4<---------MYB46(3)
--->ARR11(3) <---------ARR14(2)   ----------->HVH21 <---------LBD16 <------NtERF2--------->SPL7(1)--
--->RVE1(2) <---------CCA1(2) <---------ALFIN1--------->WOX13(1)    ------------>CBF --------->ALFIN1
=============RAV<----------DOF2 ----------->RAV1(2)----------->RAV1(2)  <---------ATHB12    --------
 
cattttgttggttccaaatctttttttaagaccccccctgacgttctaccaatcacccgggacgcagagggggcaatgatcgtgtacggtgggggagcat  13527800
                                                                              ------->TEIL
                                                                              --------->SPL7(1)
                                                                              <-------TEIL
                                                                            <---------SPL7(1)
                                                                           <---------ANAC46
         <---------AtMYB61                                                 <---------ANAC58
     --------->At5g28300                                                   <---------ANAC55(2)
   <---------DEAR3(1)                                                      --------->ANAC55(2)
  <---------ORA47(1)                                                       <---------ANAC58
 <------ZmHOX2a(1)                                                        --------------->AtSPL3
----------->HVH21      --------->ARR11(2)                             --------->At4g35610
----ARR14(2)           --------->ARR14(2)                             <------NtERF2 <---------ARR14(2)
--->GLK1(2)            <---------ARR14(2)                             <---------At4g35610
----ARR11(2)           <---------ARR11(2)                            ------>NtERF2  <---------ARR11(2)
--->ARR11(2)         <---------MYB46(3)                              <---------RAP2.3(1)
--At4g35610          <------MYB46(1)                                --------->ATERF1(2)
->At4g35610          <------MYB83                                   <---------ATERF1(2)
-------TOE2(1)      <---------DEAR3(1)                      <<<<<<<<<<<<<<<<<LFY    --------->ARR11(2)
-------TOE1(1)      <---------AtMYB61            <------NtERF2      <---------ANAC46--------->ARR14(2)
-->KAN1  --------->DOF5.7(1)                    ------>NtERF2       <---------DEAR3(1)
========HOX2a_HOX2a --------->ALFIN1        <---------DEAR3(1)      <---------RAP2.6(2)
--HSFC1(2)        <---------ANAC46         <---------ORA47(1)       <---------RAP2.3(3)
--->ARR14(2)     --------->ALFIN1--------->DOF5.7(1)   <------ZmHOX2a(1)<---------SPL7(1)        <--
------->LBD16  <---------ANAC46 --------->DOF5.7(1) <------NtERF2   <---------RAP2.3(2)          ---
->HSFC1(2)  --------->ALFIN1   ---------->DOF2 --------->ALFIN1    --------->RAP2.6(3)          ----
 
ccgaggacggtgaaggtggaggggtggttctgaagaaagggccatggacggtggccgaggacgagacactggcggcttacgtacgggaatacggtgaagg  13527900
                                                           <----------CDC5
                                                           <---------MYB52(1)
                                                          <---------ZAT2
                                                          <---------At4g35610
                                                          --------->ZAT2
                                                          ----------->RAV1(2)
                                                          --------->At4g35610
                                                       ------>NtERF2
                                                      <---------ALFIN1
                                                      --------->DEAR3(1)
                                                     <------NtERF2
                                                     --------->ATERF1(1)
                                                     --------->RAP2.3(1)
                                                    ------>NtERF2
                                                   --------->DEAR3(1)
                                                   --------->ATERF1(2)
                                                   --------->RAP2.6(2)
                                                   --------->RAP2.3(2)
                                                   <---------ATERF1(2)
                                                  --------->ATERF1(1)
                                                  --------->RAP2.3(1)
                                                  --------->ORA47(2)                        --------
                                              --------->ZAT2                                --------
                                              --------->At4g35610                         ----------
              --------->At4g35610   --------->ALFIN1<---------ATERF1(1)                  <------ZmHOX2a(1)
     --------->GLK1(2)            <------MYB83<---------At4g35610                     <-----------RAV1(2)
    --------->GLK1(1)         <---------STY1(2)  <---------ATERF1(1)              --------->RVE1(2)
    <---------GLK1(1)         --------->STY1(2)  ------>NtERF2                   ------>MYB46(1)
-------ARR14(2)            <---------ANAC58  <---------ARR11(3)                  ------>MYB83      <
------>ARR11(2)            <---------ANAC58----------->ARR10       -------->P  <---------MYB59     -
----->ZAT18   <---------At4g35610 <------MYB46(1)--------->At4g35610--------->MYB46(3)<---------LBD16
 
gaactggaattctgttcagaagaagacatggctggctaggtgtggcaagagctgccgcctccgctgggctaaccacttacgacctaatctcaggaaaggc  13528000
                                                                                   -------->HAHB4
                                                                                   --------->YAB5
                                                                                   --------->YAB1
                                                                                  <---------YAB5
                                                                                  --------->ICU4
                                                    --------->MYB46(3)     <---------TOE1(3)
                                                  ----------->RAV1(1)     <-----------RAV1(2)
            <---------------AtSPL3             --------->ANAC58        <---------ZAT2
    --------->DEAR3(1)                         --------->ANAC58        <---------At4g35610    ------
 <---------ALFIN1                          --------->ZAT2              --------->At4g35610    <-----
->DOF5.7(1)<------ZmHOX2a(1)               <---------At4g35610       <---------RAP2.3(3)    ------>ZmHOX2a(1)
->DAG2  --------->LBD16            <---------ALFIN1 <---------MYB52(2) --------->ZAT2  --------->WOX13(1)
>DOF2  --------->LBD16  <---------YAB1     <---------ZAT2     --------->ANAC58   --------->WOX13(2)
-----------HVH21        <---------YAB5     --------->At4g35610--------->ANAC58   <---------TOE2(3)
----->ZmHOX2a(1) <---------KAN1   --------->ZAT14<----------ID1 <---------AtLEC2 <---------WOX13(2)
 
tccttcacccccgaggaagaacgtctcatcatacaactccactctcagctaggcaacaaatgggctcgcatggctgctcaggttaatgatcaatcctaca  13528100
        <---------YAB1
     <---------GATA12
     --------->GATA12
  <---------AHL12(3)                                                                             ---
  --------->AHL12(3)                                                                             <--
  <---------AHL20(2)                                                                            >>>>
  <---------AHL20(3)                                                                        --------
  --------->AHL20(2)                                                           --------->ZAT2  <----
  <---------AHL25(1)                                                           --------->At4g35610
  --------->AHL25(1)                                                           <---------ZAT2-------
  --------->AHL20(3)                                                           <---------At4g35610
--->REM1(1)             <---------ANAC58                                <<<<<<<<<TBF1       <-------
----ALFIN1              <---------ANAC58                             <<<<<<<<<TBF1          --------
 
cttatataaatctgataaaactgcattgcttctctctgttttctaggcttcttagttcttcatgctctcttcttcttcttccagctctcaaaaaacttta  13528200
                                                                --------->MYB52(1)
------>MYB46(3)                                             <---------ARR11(3)
-------YAB5                                            <------ZmHOX2a(2)
>>>>>>>>>>>>>LFY                                      <---------ARR11(3)                      ------
->TOE1(3)                              <XXXXXXXXXXXXXXXXXXXXMIR858--------->HSFB2a(2)        -------
-------GT1                          --------->AtLEC2  --------->GATA12                       -------
-->DOF5.7(2)                    -------->P            --------->ARR11(3)            --------->ANAC58
---DOF2                        <-----------GT1  --------->MYB52(1)<---------HSFB2a(2)        -------
->TOE2(3)       <---------MYB52(1) --------->ANAC46   <---------GATA12              --------->ANAC58
 
accattgtcttcttctactgtttgttttgaatagttaccaggcagaacagataacgagatcaagaactactggaacacgaggttgaaacgcttccaacgc  13528300
<- Previous    Next ->

AGI:  At4g26930.1   
Description:  MYB97 (myb domain protein 97); DNA binding / transcription factor. similar to MYB120 (myb domain protein 120), DNA binding / transcription factor [Arabidopsis thaliana] (TAIR:AT5G55020.1); similar to protein 3 [Petunia x hybrida] (GB:CAA78388.1); contains InterPro domain Myb transcription factor (InterPro:IPR015495); contains InterPro domain Homeodomain-related; (InterPro:IPR012287); contains InterPro domain SANT, DNA-binding; (InterPro:IPR001005); contains InterPro domain Homeodomain-like (InterPro:IPR009057); contains InterPro domain Myb, DNA-binding (InterPro:IPR014778)
Range:  from: 13527776    to: 13529178    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version