AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                  <---------GATA12
                                  <---------ARR14(3)
                                  <---------ARR11(3)
                                  --------->ARR11(3)
                              <---------LBD16
                             <---------LBD16
                            ========================HOX2a_HOX2a
                       <-----------bZIP910(2)
                     <-----------TGA1
                    --------->ANAC58
                    <---------ANAC46
                    --------->ANAC55(2)
                    >>>>>>>>>>HY5 --------->ARR14(2)
                    --------->ANAC58
                    <---------ANAC55(2)
                    <---------bZIP60(2)           --------->ETT(2)
                    --------->O2  <---------ARR14(2)
                    --------->TGA1a               <---------ETT(2)
   <---------KAN1----------->HVH21<---------RVE1(2)
  <---------ARR14(2)<---------O2  <---------ARR11(2)
  --------->ARR11(2)<---------TGA1a               ----------->HVH21
  <---------ARR11(2)--------->TGA2(1)      <---------GATA12
  --------->ARR14(2)--------->bZIP60(2)    <---------ARR11(2)              <------MYB83
  --------->GLK1(2) --------->bZIP60(1)    --------->ARR11(2)              <------MYB46(1)
  --------->RVE1(2) <---------TGA2(1)      <---------ARR14(2)    ================MYC_MYB
  ------->TEIL   ----------->TGA1 --------->ARR11(2)             --------->TGA1a
  --------->GATA12  <---------bZIP60(1)    --------->GATA12      <---------TGA1a
  <---------GATA12<---------TGA2(2)        --------->ARR14(2)    <---------O2
  <---------ARR11(1)===============================================MYC_MYB<------MYB83
  <-----------ARR10----------->STF1 ------>ZmHOX2a(2)       --------->MYB52(2)
 <---------ARR14(1)<-----------STF1<------ZmHOX2a(2)      =================MYC_MYB
-----At4g35610 <---------ANAC58   --------->ARR14(3)      <--------P      --------->MYB59         <-
---->At4g35610 <---------ANAC58--------->LBD16    --------->WRKY38(1)     <------MYB46(1)         --
-----ZAT2      <---------MYB46(3) --------->GATA12<---------WRKY38(1)     <---------MYB46(3)  ------
---->ZAT2  --------->MYB59  ==============HOX2a_HOX2a   --------->LBD16  --------->ALFIN1  ---------
-----GLK1(1)<------MYB46(1) ------>ZmHOX2a(1)------>ZmHOX2a(2)   --------->O2              <--------
---->GLK1(1)<------MYB83    ===============HOX2a_HOX2a<---------LBD16   <--------P        --------->ANAC58
-REM1(1)  <-------TEIL--------->TGA2(2)  --------->ETT(2) <---------MYB52(1)              --------->ANAC58
 
ctccgaatctaggttcggtcgtgacgtcatcctccgggatcttgtcgatcgggtcgacccggttagtctcgtcgggttgggtcatgagctcgtaagcagc  13240900
                                                                                               <----
                                                                                            <-------
                                                                                            --------
                                                                                            --------
                                                                                            <-------
                                                                                       <--------P
                                                                                  <-------TEIL -----
                                                                                <---------PCF2------
                                                                               <------MYB83 <-------
                                                                               <---------DEAR3(2)
                                                                               <------MYB46(1)------
                                                                              <---------MYB46(3)   <
                                                                             --------->ALFIN1<------ZmHOX2a(2)
     ------>ZmHOX2a(1)                               <-----------GT1       --------->ZAT2--------->MYB59
--------ARR14(2)                                    ----------->HVH21     --------->ALFIN1  --------
------->ARR14(2)                                 <---------RVE1(2)       <------ZmHOX2a(1) =========
--->At4g35610       <---------ANAC46             <---------GATA12        ===========================
>At4g35610        <---------ANAC46            <---------WOX13(1)         ===========================HOX2a_HOX2a
-At4g35610     <-----------RAV1(1)      <---------KAN1                  --------->DOF5.7(1)<------ZmHOX2a(1)
 
gtaatctccttcagaattgtgttgtgggaacttgaagtaaggcatgttgatggatttgacccgttgcaagagagaaggaggtgggttcgggttaggatcc  13241000
                   --------->GLK1(2)
                  <---------RVE1(2)
                  <---------ARR11(2)
                  <---------GLK1(2)
                  --------->ARR14(2)
                  --------->ARR11(2)
           --------->ARR11(3)
           --------->ARR11(2)
           --------->GATA12
     --------->ALFIN1
 --------->LBD16  <---------ARR14(2)
-----ETT(1)<---------GATA12
--ARR14(2) <---------AGP1<---------REM1(1)
->ARR11(2) <---------ARR11(3)
->ARR14(2) <---------ARR14(2)                                                                  <----
--GATA12   --------->ARR14(2)                                                                  <----
------>HVH21 ========================HOX2a_HOX2a                                            <-------
--->DEAR3(2) ------>ZmHOX2a(2)                                                              --------
--ARR11(2) <---------ARR11(2)                                                       --------->GATA12
>ZmHOX2a(2)<---------RVE1(2)                                --------->ZAT14         <---------GATA12
---------LBD16<---------LBD16                               <---------ZAT14         --------->ARR14(2)
->GATA12  <---------CCA1(2)                                <----------DOF2          <---------ARR14(2)
====================HOX2a_HOX2a                          ------->TEIL            <------ZmHOX2a(1)
=HOX2a_HOX2a<---------GLK1(1) <------ZmHOX2a(1)       <---------WOX13(1)        --------->DOF5.7(1)
 
gacccggagtagtggatctcggattctggtgaaggagaattgtacagatggaagttgatggactttactctgtctatgagcgaaggaggtctgccaaacc  13241100
                                ------->GAMYB
                               <---------YAB5
                             --------->ARR11(2)
                             <---------ARR11(2)
                           --------->LBD16
                          --------->ANAC58                                    <------MYB83
                          <---------ANAC55(2)                                 <------MYB46(1)      =
                          --------->ANAC58             <-----------------AGL1<---------MYB46(3)    =
                          --------->ANAC55(1)<---------ANAC58                --------->MYB111(2)   =
                          --------->ANAC46   <---------ANAC46                --------->MYB46(2)    -
                          --------->ANAC55(2)<---------ANAC58                --------->MYB55(2)    -
                     ----------->HVH21       <-------GAMYB                   <---------AtMYB61    ==
                     --------->MYB46(3)     <------MYB46(1)                 <--------P            ==
                     --------->DEAR3(1)     --------->MYB55(2)              <---------MYB55(1)    ==
   <---------RVE1(2)--------->SPL7(1)       <------MYB83<---------------AGL15<---------DEAR3(1)   <-
<-----------------AGL1------>NtERF2         <---------MYB46(3)             <---------MYB52(1)  <----
-----ANAC58       ----------->HVH21         --------->MYB52(2)         ------->TEIL            <----
-----ANAC58      --------->MYB46(3)        <---------AtMYB61     --------->ARR14(2)           <-----
--ARR11(2)       --------->DEAR3(2)     <-----------RAV1(1)     <------ZmHOX2a(1)           <-------
->MYB52(1)   ----------->HVH21 --------->MYB46(3)<---------ANAC46<---------ARR14(2)<---------YAB1<--
 
gtgcctgattttggtcatgacccgacgacccgtaaccatcttgatgttggttgtgttttcttgaacaggaactgaaccggttggtgatgaaaatggtggc  13241200
     --------->WOX13(2)
==================HOX2a_HOX2a
=====================HOX2a_HOX2a
========================HOX2a_HOX2a
---------->GT1
----->ZmHOX2a(2)                                                                            <-------
==================HOX2a_HOX2a                                                              *TSS
=====================HOX2a_HOX2a                                                         <---------ZAT6
========================HOX2a_HOX2a           --------->WRKY18(1)                        <---------ANAC46
-----ZmHOX2a(2)          <---------YAB5     <------MYB83                            <---------ANAC58
-----ANAC58      <------ZmHOX2a(1)        <--------P                           <---------ANAC58
-----ANAC58 --------->ALFIN1        <-----------GT1<---------ANAC58            <---------ANAC46
-NtERF2  <---------TOE2(3)   <---------DEAR3(1)    <---------ANAC58            <---------ANAC58
--DEAR3(1) <------ZmHOX2a(1)<------NtERF2 <---------MYB52(1)   >>>>>>>>>>>>>>>>>LFY <---------ANAC46
-------GATA12 <------ZmHOX2a(1)<------NtERF2<------MYB46(1)  --------->At4g35610    <---------ANAC58
 
gatcgtgaaattgaggaggaggaagagagtcgtcggagttaaccagttggtcaagcttgtgagtagctccattgttgtttttgtgtgtcgtagagtgaag  13241300
                             <---------AHL25(2)
                             --------->AHL25(2)
                            <---------RVE1(1)
                 --------->AHL20(2)
                 <---------AHL25(1)
                 <---------AHL20(2)
                 --------->AHL12(3)
                 --------->AHL25(1)
                 <---------AHL12(3)
               <---------AHL12(3)                   --------->YAB1
               --------->AHL12(3)                   <---------ICU4
               <-----------TBP                    <---------YAB1
               <---------AHL12(2)                --------->TOE2(3)
              <---------ICU4<---------CCA1(1)   <---------ICU4
             <---------AHL12(1)                <---------ATHB12
             --------->ICU4<---------ARR11(3)  --------->ICU4
            --------->AHL20(3)        <---------ANAC58               --------->GATA12
            <---------AHL25(2)        <---------ANAC58               <---------RVE1(2)
            --------->AHL12(2)--------->AHL12(2)--------->YAB1       <---------GATA12
            <---------AHL20(3)--------->AHL12(3)--------->ATHB12   ----------->ARR10               <
            --------->AHL25(2)<---------AHL12(3)<--------HAHB4   <---------MYB52(1)         --------
            <---------AHL12(2)<---------AHL12(2)--------->YAB5 <---------ANAC46          ---------->ID1
         <---------RVE1(2) --------->ARR11(3)  <---------YAB5  <---------ANAC58      <----------DOF2
--ZAT14----------->GT1     <---------RVE1(2)   <---------YAB1  <---------ANAC58     <---------DOF5.7(1)
 
aatgaagtagtggataatatttatattagagatattttttgtcttggttaatcattaatgacccttgcgttagatttgttgtatgggtctttgttttttt  13241400
                                                                                                  <-
                                                                                                 ---
                                                                                             -------
                                                                                             <------
                                                                                            <-------
                                                              <-----------GT1               --------
                                                            <---------AHL25(3)             ---------
                                  --------->ATHB12          <---------AHL20(2)             <--------
                                 <---------YAB1             <---------AHL25(1)         --------->ANAC46
                        <----------DOF2                     --------->AHL20(2)         --------->ANAC55(2)
       --------->AHL25(3)        <---------YAB5             --------->AHL25(1)         ----------->GT1
   ----------->GT1     <---------DOF5.7(1)                <---------WOX13(2)          <---------TOE1(3)
---------RVE1(2)      ---------->ID1<---------WOX13(1)    --------->WOX13(2)          <---------TOE2(3)
->AHL12(2)   <-----------GT1   --------->YAB1   ---------->DOF2 --------->ZAT6<---------AtMYB61<----
 
ttcatatggttttatttatcaatttgtctttctatattgattgttttctaacaaagtcagaaattaaacagtacatatgttttggtcttaacgtaattat  13241500
                                                        <------ZmHOX2a(2)
                                                       <---------ARR11(3)
--------->AHL20(2)                                     --------->ARR11(3)
--------WOX13(2)                                       --------->RVE1(2)
-------->GT1                                         ----------->ARR10
-->YAB1                                       --------->REM1(2)
---ICU4                                       <---------ZAT14
--YAB5                                        --------->ZAT14                              ---------
->ICU4                                       <---------ANAC46                --------->GATA12
>WOX13(2)                                <---------ANAC58                   --------->REM1(1)
-WOX13(2)          <---------AtMYB61     <---------ANAC46                  <-------TEIL    ---------
-----YAB1 ------>ZmHOX2a(1)              <---------ANAC58              ----------->GT1----------->HVH21
 
cagttaaatagtccttgtagttgtggttttgtttagtatttgtgacttgtgtagagaagatcatccatttgaaatagttacatctatttctgacaggcta  13241600
                                                       ----------->HVH21
                                                   ------->GAMYB
                                     <---------GATA12 --------->LBD16                        -------
                   --------->ATHB12  --------->GATA12--------->O2                  <---------ICU4
              <-----------GT1     <---------AHL25(1) --------->ANAC46              --------->YAB1
          --------->ATHB51        --------->AHL25(1) <---------O2                 <---------YAB5
          --------->ATHB12        --------->AHL20(2)<---------LBD16             --------->YAB1
>ANAC58  <---------YAB1      <---------TOE2(3)  <-----------GT1                 <---------ICU4    --
>ANAC58 --------->TOE2(3) --------->MYB46(3)  <---------AHL20(2)               --------->ICU4=======
 
caaaactcttacattattgacctcattgaaccaaggtttaaatctgtattttaaccccgtgactctattgtctcatcggctcataatcatcttcttccct  13241700
           <----------DOF2
 <---------ALFIN1   <---------------AtSPL3
 ----------->RAV1(1)<---------------AtSPL8                                                       <--
--------->RAP2.3(3) --------------->AtSPL3                                                       ---
--------->ZAT18     <---------YAB5                                                           -------
<---------ZAT18  --------->KAN1               <---------ANAC58                   <----------DOF2 ---
---->RAV1(2)   --------->YAB1                 <---------ANAC58              <---------ANAC58<-------
------->PCF2  <---------YAB1             --------->KAN1  --------->KAN1     <---------ANAC58<-------
=============RAV<---------RVE1(2)   --------->YAB1   <----------DOF2   --------->YAB1  --------->TOE2(3)
 
gagcccacatttttcttttgataatcgtacagttttctaacatcacattccttgagctttttattctatttcaaaaatagcttacttttacataaatcat  13241800
<- Previous    Next ->

AGI:  At4g26130.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G56980.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN72576.1)
Range:  from: 13239988    to: 13241292    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version