AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                               <---------DOF5.7(1)
                                                                              <---------DAG2
                                                                              <---------DOF5.7(1)
                                                                           <---------ALFIN1
                                                                      --------->ARR14(2)
                                                                      <---------ARR11(1)
                                                                      <---------ARR14(2)
                                                                      <-----------ARR10
                                                                      --------->RVE1(2)
                                                                     ------>MYB83                  -
                                                           <---------At4g35610<----------DOF2     --
                                                    <---------AHL20(1)<---------GATA12     <--------
                   --------->DOF5.7(1)              --------->ARR11(3)--------->GATA12     ---------
         <---------DAG2               <----------DOF2--------->KAN1<---------MYB111(1)     ---------
         <----------DOF2         <-----------GT1    <---------RVE1(2)------>MYB46(1)   <----------DOF2
-------->KAN1    ---------->DOF2<-----------GT1  --------->AHL20(2)<---------MYB59  <-----------GT1<
 
gaaaattccatacttttttaaaaagacaatttgttttatcactttagtttttttatatattcagcgtctaccaaatctacacttttttttctttctcgat  13038000
                                                                                                  <-
                                                                                                  --
                                                                                                  <-
                                                                                                  --
                                                                                                  <-
                                                                                                  <-
                                                                                                  --
                                                                                                  <-
                                                                                                 <--
                                                                                                 ---
                                                                                                 ---
                                                                                                 <--
                                                                                                 ---
                                                                                                 <--
    <---------YAB5                                      --------->WOX13(2)                       ---
-------->WOX13(2)    <---------ANAC55(2)              <---------AHL20(2)                         <--
--------->GT1        --------->ANAC55(2)          <---------RVE1(1)                              ---
-------AGL15       <---------ANAC46               <---------CCA1(1)                     <------MYB46(1)
------>AGL15<---------ANAC58                     <---------RVE1(2)                      <------MYB83
>HSFB2a(2)  <---------ANAC58     <---------YAB1  --------->ARR11(3)                     <---------MYB46(3)
---------WOX13(2)<-----------HVH21               <---------ARR11(3)<---------AHL25(3)   ----------->GT1
 
ttagttaatcttcgttcttgtgtcatgtaatagattactatttcaaaacatagatatttagttatctaaataaaactaggccatccatggatggtttcaa  13038100
            ---------->DOF2
          <---------YAB1
--------AHL25(2)
------->AHL25(1)
--------AHL25(3)
------->AHL25(2)                                                        <---------WOX13(2)
--------AHL25(1)                                     --------------->AGL15
--------AHL20(2)                                     <---------------AGL15
------->AHL12(3)                                    ----------------->AGL2
--------AHL12(3)                                    ----------------->AGL3
-------AHL20(1)                                     <-----------------AGL3
------>AHL12(1)                                --------->ATHB12         <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)
------>AHL20(2)                                --------->YAB1           --------->WOX13(2)
-------AHL12(1)         <---------AHL12(2)     --------->YAB5       --------->RVE1(2)
------>AHL25(1)         --------->AHL12(2) --------->ATHB12         --------->GLK1(2)    <---------ANAC58
-------AHL20(2)     ----------->GT1       <---------YAB5       ---------->DOF2           <---------ANAC58
------>AHL25(3)    ----------->GT1        <---------YAB1--------->WOX13(2)         <---------ZAT6
-------AHL25(2)   --------->DAG2        --------->YAB1  <---------WOX13(2)       <---------ANAC46<--
------>AHL25(2)  ---------->DOF2  <-----------GT1   <-----------------AGL2  <---------ANAC46     <--
 
ttttttttttcatatgaaagaaaagttaaatttcatttcacaataaccattgattactaaatttagtaaagaatcaattgggtttagtgtttacttgttt  13038200
                                                                                           <xxxxxxxx
                                                                                --------->GLK1(2)
                                                                                <---------GATA12
                                                                                --------->RVE1(2)
                                                                            <---------HSFB2a(2)
                                                                    <----------DOF2     <xxxxxxxxxxx
                                                            xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(l2)      --------->HSFB2a(2)
                                xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)   <---------ANAC46--------->KAN1
                     <---------YAB1  <---------YAB1    <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3) <------
             <----------DOF2  --------->YAB1  --------->CCA1(2)    <---------DOF5.7(1)<---------CCA1(2)
          <-----------GT1xxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
   --------->AHL12(2)<---------TOE1(3)  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)  <---------GLK1(2)   <
-------TOE2(3)       <---------YAB5 --------->RVE1(2) <------NtERF2<xxxxxxxxxxxxxxxxsmallRNA(i)    <
-------TOE1(3)       <---------TOE2(3) ---------->DOF2<---------ATERF1(1)  <---------ETT(2)<xxxxxxxx
 
aaggttttttttttttcttttgttatggttctatactaatatcaaagagttatgggccgaagcccatacatctttccgtcgagaatctcatatattcttt  13038300
                         --------->RVE1(2)
                         --------->GLK1(2)
                        <---------GLK1(2)                           ------>NtERF2  <---------ANAC58
                     <---------HSFB2a(2)                            *TSS--------->STY1(1)
                     --------->HSFB2a(2)                            --------->At4g35610
                    <---------ETT(2)                               --------->RAP2.3(2)
                 <---------ANAC46                                 --------->ATERF1(1)
             <----------DOF2                                      --------->DEAR4(2)
            <xxxxxxxxxxxxxxxxsmallRNA(i)                          <------NtERF2    <---------ANAC58
     xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)                        --------->ORA47(2)
     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)                        --------->RAP2.3(1)   --------->ANAC46
xxxxxxxxxxxxxxxsmallRNA(si3)                 <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(s2) xxxxxxxxxxxxxxxx>smallRNA(i)
xxxxxxxxxxxxsmallRNA(si3)<---------GATA12--------->RVE1(2)       <---------RAP2.3(1)<---------DAG2
----DOF2    <---------DOF5.7(1)       <---------DAG2     --------->TOE1(2)       <-----------GT1
xxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)   --------->TOE2(3) --------->YAB1<----------DOF2   <xxxxxxxxxxx
xxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)   --------->TOE1(3)<-------TEIL--------->DEAR3(1)  ---------->ID1
xxxxxxxxxxxxxxxsmallRNA(le3)       <-----------GT1 <---------YAB5<---------ATERF1(1)<----------DOF2
 
atcgaagcccatacatctttccgtcgagaatctcatatataccttatcccattcaacattcatacgagcgccgctctagggtttttgcttttcgccattg  13038400
                                                  --------->AHL20(3)
                                                  <---------AHL20(3)
                                                  --------->AHL25(2)
                                                  <---------AHL25(2)
                                                  --------->AHL12(3)
                                                --------->AHL25(3)
                                                <---------YAB1
                                                --------->AHL25(1)
                                                <---------AHL25(1)
                                                <---------AHL12(3)
                                                --------->AHL12(3)
                                                <---------AHL25(2)
                                                --------->AHL25(2)
                                               <---------AHL20(1)
                                               --------->AHL12(2)
                                   --------->ANAC46  <---------AHL20(3)
                                   --------->ANAC58  --------->AHL20(3)
                                   --------->ANAC58  <---------AHL20(2)
                                  <---------ZAT18 <---------AHL20(1)
                              <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)
                              <xxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
                              <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
                           <----------DOF2     --------->AHL12(3)
                          <---------ANAC46     <---------AHL20(3)
                    <---------TOE2(3)    --------->TOE2(3)
                    <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
               <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)<---------AHL12(2)
              <---------MYB46(3)<---------At4g35610<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
              xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)<---------YAB1                         --------->ARR14(2)
             xxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3) <---------AHL20(2)                      <---------ARR11(2)
             <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)<---------AHL20(2)                 xxxxxxxxxxxxxxxx>smallRNA(fl3)
            <---------ANAC58  <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)                xxxxxxxxxxxxxxxxxxx
            <---------ANAC58 <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)                xxxxxxxxxxxxxxxxxxx
            <-------GAMYB <xxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)                   <xxxxxxxxxxxxxxxxxxxx
           <------MYB46(1)<---------ANAC58     --------->AHL20(3)         xxxxxxxxxxxxxxxx>smallRNA(i)
           <------MYB83   <---------ANAC58     --------->AHL25(2)         xxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
        <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)  <---------AHL25(2)      <---------YAB1     --------->ARR11(2)
       xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)--------->YAB1            <---------TOE1(2)   <---------RVE1(2)
      <----------DOF2  <--------P --------->ZAT18 --------->AHL12(2) <-----------GT1      <---------ARR14(2)
xxxxxsmallRNA(i)    <---------TOE1(3)    <----------DOF2      <-----------GT1<-----------GT1      --
 
gtccaagtgctatttggttgtttaaggttgcttttagcacacaactttaatattatttttatgtttttcttcttacgatttatcgatttgtgggatactg  13038500
                                             ------>NtERF2
                                            --------->DEAR3(1)
                                            --------->RAP2.3(2)
                                           <------NtERF2
                                           --------->ATERF1(1)
                                           --------->RAP2.3(1)
                                           --------->ORA47(2)
                                          ------>NtERF2
                                          <---------RRTF1(1)
                                     ------>ZmHOX2a(2)
                                    <------ZmHOX2a(2)
                                   <---------ARR11(2)
                                   <---------RVE1(2)
                                   --------->ARR14(2)
                                   <---------ARR14(3)
                                   <---------AGP1
                                   --------->ARR14(3)
                                   <-----------ARR10
                                   <---------GATA12                                            <----
                                   --------->ARR11(2)                                <---------TOE2(3)
                                   --------->GATA12                              <---------DAG2<----
        <---------YAB1             --------->AGP1<----------DOF2                 <----------DOF2
     <---------YAB1                --------->ARR11(3)                      <---------ALFIN1   <-----
    <---------GLK1(2)              <---------ARR11(3)                     <---------ABI4(2)   <-----
 --------->YAB1                    <---------ARR14(2)               --------->TOE1(2)<---------TOE1(3)
xxx>smallRNA(i2)              --------->RVE1(2) <---------DOF5.7(1)--------->YAB1<---------DOF5.7(1)
xxxx>smallRNA(i2)            <---------KAN1--------->DEAR4(2)     <-------TEIL  <---------DOF5.7(1)
xxxsmallRNA(fl3)      --------->ANAC46    <---------RAP2.3(1) <---------YAB5  --------->DEAR3(1)
------->WOX13(1)  <-----------GT1 <---------CCA1(2)     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(s2)<-------
 
acaatcagattattgttgttttttccagccaaatatcagatcttgcgccgctctttatcccattcaacattcatacgagcaccgctttacggtttttgct  13038600
                                                             --------->AHL12(3)
                                                             <---------AHL20(1)
                                                             --------->AHL25(2)
                                                             <---------AHL25(2)
                                                             <---------AHL20(3)
                                                           <---------YAB1
                                                           <---------AHL12(3)
                                                           --------->AHL12(3)
                                                           <---------AHL25(1)
                                                           --------->AHL25(2)
                                                           <---------AHL25(2)
                                                           --------->AHL25(3)
                                                           --------->AHL25(1)
                                              --------->ANAC58
                                              --------->ANAC46  <---------AHL20(2)
                                         <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
                                         <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
                                         <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)
                                      <----------DOF2     <---------AHL20(1)
                                     <---------ANAC46     <---------AHL20(3)
                               <---------TOE2(3)          --------->AHL25(2)
                               <---------TOE1(3)          --------->AHL12(2)
                               <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
                          <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)  <---------AHL20(3)
                         xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)  --------->AHL20(3)
                         <---------MYB46(3)<---------At4g35610<---------AHL12(2)
                        xxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3) --------->AHL20(3)
                        <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)<---------AHL20(2)
                       <---------ANAC58  <xxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
                       <---------ANAC58 <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)
                       <-------GAMYB <---------ANAC58     --------->AHL20(3)
                      <------MYB83   <xxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
                   <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)  <---------AHL25(2)
         xxxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)     <----------DOF2                          <xxxxxx
<<<<<<<<<<<<<<<<<LFY  <------MYB46(1)<---------ANAC58     --------->AHL12(3)           <-----------GT1
-----DAG2xxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)  --------->ANAC58<---------YAB1        xxxxxxxxxxxxxxxx
------DOF2        xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)--------->YAB1             <xxxxxxxxxxxxxxxxx
----ANAC58       <----------DOF2  <--------P <---------ZAT18 <---------AHL20(2)  <---------YAB1
----ANAC58  <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)    --------->TOE2(3)           <---------TOE1(2)
----GT1<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3) --------->ZAT18 --------->AHL12(2)<-----------GT1     <
 
tttcgacattggtcgaagtgctatttggttgtttaaggttgcttttagcacacaactttaatattatttttatgttttcttcttacgatttatcgatttg  13038700
                                                    <-----------GT1
              <---------GLK1(2)                 <---------AHL12(3)
              <---------RVE1(2)                 <---------AHL20(3)
              --------->GATA12                  --------->AHL20(3)
           --------->YAB1                       <---------AHL20(2)
        --------->WOX13(1)                      --------->AHL25(1)                 --------->LBD16
--------->ARR11(3)                             --------->AHL25(3)                 --------->HSFB2a(2)
--------->ARR14(2)                             <---------AHL12(1)              <---------ARR11(2)
<---------ARR14(2)                             --------->AHL12(1)              --------->ARR11(2)
<---------ARR11(2)                            <---------RVE1(1)         --------->ARR11(3)
--------->ARR11(2)                           --------->ARR11(3)        --------->YAB5
<---------RVE1(2)                            <---------GLK1(2)         --------->ATHB12           --
xxxxxxxxxxxxxxxxsmallRNA(i2)                 --------->GATA12         --------->ICU4 --------->GATA12
>smallRNA(i)  --------->ARR11(3)             <---------RVE1(2)        <---------YAB5 --------->ARR14(2)
xxxxxxsmallRNA(si3)  ---------->ID1     --------->RVE1(2)             <---------KAN1 <---------ARR14(2)
------ZmHOX2a(1)   <-----------RAV1(1)---------->DOF2               xxxxxxxxxxxxxxxxxx>smallRNA(fl3)
 
taggatactgacaatcagatttttgttgtttttttcagccaaaaatcagatttttttacattttgtttagagaatgattttggttcccgatttgtctgtt  13038800
                               <---------ZAT6
                         --------->ARR11(3)
                         --------->AHL12(1)
                         <---------AHL25(2)
                         <---------AHL12(1)
                         --------->AHL25(2)
                         <---------AHL20(1)                                       <-------GAMYB
                         --------->AHL20(1)               <---------AHL12(1)     <---------MYB46(3)
                        --------->AHL12(3)        --------->ARR11(2)             --------->MYB52(2)
           <---------------AtSPL8    --------->ZAT6       --------->AHL12(1) --------->KAN1
          ---------->DOF2<---------AHL20(3)       <---------ARR11(2)       <---------ANAC58
     <---------ANAC46   --------->AHL12(2)        --------->ARR14(2)       <---------ANAC58
   <---------KAN1       <---------AHL12(2)       <---------GLK1(1)--------->ARR11(3)
  <----------DOF2       <---------AHL12(3)       --------->GLK1(1)<---------ARR11(3)
-------->ID1     <----------DOF2   <-----------GT1<---------ARR14(2) <----------DOF2
 
tttcgcttatgtgtaaagtactttgaaaaatattgtgttaactctacaatgggtatcccaaatttttgagttcttttgtcttgttcgttgtcgagacact  13038900
<- Previous    Next ->

AGI:  At4g25530.1   
Description:  FWA; DNA binding / transcription factor. Identical to Homeobox protein FWA (FWA) [Arabidopsis Thaliana] (GB:Q9FVI6;GB:O65608;GB:Q9M0K7); similar to HDG7 (HOMEODOMAIN GLABROUS7), DNA binding / sequence-specific DNA binding / transcription factor [Arabidopsis thaliana] (TAIR:AT5G52170.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN61351.1); contains InterPro domain Homeodomain-related; (InterPro:IPR012287); contains InterPro domain Lipid-binding START (InterPro:IPR002913); contains InterPro domain Homeodomain-like (InterPro:IPR009057); contains InterPro domain Homeobox; (InterPro:IPR001356)
Range:  from: 13038369    to: 13042452    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version