AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                ------>ZmHOX2a(1)
                --------------------->WRI1
           --------->GLK1(1)
           <---------At4g35610                                                    <---------HSFC1(2)
          --------->GATA12                                                        --------->HSFB2a(1)
       --------->ANAC58                                                           <---------HSFB2a(1)
       --------->ANAC58                 --------->ARR11(3)                        --------->HSFC1(2)
 --------------------->WRI1             --------->GATA12                      --------->DEAR3(1)
 ------>ZmHOX2a(1)                     <---------CCA1(2)                    ------->GAMYB
-----GATA12<---------GLK1(1)   ------>ZmHOX2a(1)     <---------ZAT14   ------>ZmHOX2a(1)        <---
---->GATA12<---------KAN1 <---------At4g35610        --------->ZAT14  --------->ANAC46       <------
 
tctccttcgctcgcatctccttcgctctcatctccttcgctcacatcttgtgactctaaactgttctcggtctcctcaacagcgacgcttccttctccac  12767700
             --------->LBD16                             <------MYB46(1)                     -------
         <---------GATA12                     <---------AHL12(1)                           ---------
         --------->ARR14(2)            --------->DOF5.7(1)                         --------->ANAC58
         --------->RVE1(2)            --------->DOF5.7(1)<------MYB83              =================
         <---------ARR14(2)         ---------->DOF2    --------->ALFIN1            <---------TGA1a
         --------->ARR11(2)     <----------ID1--------->AHL12(1)                   --------->ANAC58
    <---------At4g35610   <---------MYB52(2)<---------ARR14(2)                     <---------O2
    --------->At4g35610<---------WRKY38(1)  <---------RVE1(2) <---------AtMYB61    =================
------DOF5.7(1)       <XXXXXXXXXXXXXXXXXXXXXXXMIR836<---------TOE1(3)            --------->KAN1  ---
---ALFIN1<---------ARR11(2)    <------ZmHOX2a(1)    <---------TOE2(3)            --------->CCA1(2)
 
cttcttcagcccaatccgaagtctgggcaacgaaggagacaaagggggattttttaaggtgggttttggttttaagagatagagagacgcgagagaaaga  12767800
                          ----------->GT1
                  <---------MYB52(1)
               --------->SPL7(1)
             <---------SPL7(1)
    <------MYB46(1)    <------ZmHOX2a(1)         <---------HSFB2a(2)
    <------MYB83 --------->LBD16                 --------->HSFB2a(2)
    ----------->GT1<--------P         --------->ZAT2
  <-----------RAV1(2)--------->DOF5.7(1)     --------->ARR14(2)
-->DOF5.7(1)<---------ANAC58          <---------ZAT2  <------ZmHOX2a(1)            ----------->GT1
->DOF2  --------->KAN1--------->DOF5.7(1)    <---------ARR14(2)                <------ZmHOX2a(1)
============================MYC_MYB   <---------At4g35610              <xxxxxxxxxxxxxxxxsmallRNA(s)
==bZIP_DOF  <---------ANAC58--------->ARR11(2)  <---------LBD16      <------ZmHOX2a(1)
------>ALFIN1<-----------HVH21        --------->At4g35610  --------->CCA1(2)  --------->DOF5.7(1) <x
 
gaggggcaggttaatgcgtccggtaaggagggaaacactggagctgcgaattctggaggaagagatggtagaggagatggaaggatgggagaaaatggta  12767900
                    ---------->DOF2
       --------->ARR11(2)
       --------->GLK1(2)
       --------->ARR14(2)
       <---------ARR14(2)            ----------->GT1
      <---------ARR14(2)      --------->ANAC46
     <---------HSFB2a(1)      --------->ANAC58
     <---------HSFC1(2)       --------->ANAC58                                            --------->ALFIN1
  <------ZmHOX2a(1) --------->MYB52(1)              --------->ANAC58                --------->ALFIN1
xxxxxxxxxxxxxxxxxxsmallRNA(se3)     <---------ZAT6  --------->ANAC58       --------->CCA1(2)    <---
 
gaagaggaagaatcggccatggctaaaggcttcaagctagaggtaactatagaagaagccattgctgaattgtgagagatagaagaagtggaagtggaag  12768000
                                                   <---------KAN1
                                                 *TSS --------->DOF5.7(1)
                                                 <------ZmHOX2a(1)                                 -
                                                 --------->YAB1                                 ----
                                             --------->CCA1(2)<------NtERF2                    <----
                                     <---------MYB46(3) --------->ALFIN1                      <-----
          --------->DOF5.7(1)        <---------DEAR3(1)<------ZmHOX2a(1)                     <------
       --------->DOF5.7(1)  --------->HSFB2a(2)<---------TOE1(3)                          <---------RVE1(2)
     ---------->DOF2        <---------HSFB2a(2)<---------TOE2(3)                          <---------GATA12
---ZmHOX2a(1) <------ZmHOX2a(1)     --------->ALFIN1 --------->DOF5.7(1)                  --------->GATA12
 
gagaagagaaaagaagaggaagggaagggttttagaacggtgggcgagataaggataaggagggccgagacatcatcttcaaatgggctcttagatttac  12768100
      --------->RVE1(2)
      <---------ARR11(3)
      --------->ARR11(3)
<---------WOX13(2)
---------->GT1                      <-----------GT1                        --------->ANAC58
----->TOE2(3)          ---------->DOF2                         <-----------GT1
-----YAB1             --------->TOE1(2)                   <---------AHL12(1)
----At5g28300    --------->ANAC58<---------AHL12(2)   ----------->GT1      --------->ANAC58 <-------
-----GT1         --------->ANAC58--------->AHL12(2) ---------->DOF2--------->RVE1(2)----------->GT1-
 
catagttaaaatctcattacaagaaccaaagacaaaaaataaccatgtccctctgcaaagaaaatttcacaatctcttacgaaaacaaggtttatataaa  12768200
                             <---------AHL25(3)
                           <---------AHL12(2)
                           --------->AHL20(3)
                           <---------AHL25(2)
                           --------->AHL25(2)
                           <---------AHL20(3)
                           --------->AHL20(2)
                           <---------AHL12(3)
                           --------->AHL20(1)
                          --------->YAB1
                          --------->AHL12(2)
                          <---------AHL12(2)
                        --------->AHL20(3)
                        <---------AHL20(2)                                                 ---------
                        <---------AHL20(3)                          <-----------GT1        <--------
                        --------->AHL20(2)                      >>>>>>>ZML2           --------->YAB1
 --------->YAB1     <---------YAB1                           --------->ARR11(3) --------->TOE2(3)
<---------YAB1    --------->YAB1                         ---------->DOF2        --------->YAB1
--AHL20(2)       <---------AHL20(2)                    <---------ATHB12         --------->YAB5
-------->RVE1(2) <---------YAB1     ---------->DOF2   --------->RVE1(2)        ----------->GT1
 
cttatcaaaacgaagtttatattataaaaaaataatacacaaagtctatataactcaaatcaaagttctagtcacaatttgaatgttaatcttacttcat  12768300
                                      --------->ANAC58
                             <---------WOX13(2)
                        ----------->GT1                                    <---------AHL12(2)
                 <---------WOX13(2)   --------->ANAC58                --------->AHL20(2)
                 --------->WOX13(2)  --------->SPL7(1)              ----------->GT1   --------->AHL20(2)
     <-----------GT1   <---------RVE1(2)                    <---------ALFIN1       ------>MYB83
------>AGL15 --------->YAB1  --------->WOX13(2)             --------->ANAC58       ------>MYB46(1)
-------AGL15 --------->TOE2(3)      <--------P              --------->ANAC58  <-----------GT1
 
tttggaaattactctatgttaatttggatgttaatttgggtaagcccctctacatgtaaacacacacactcatgtaaatataaacccacttaaatttgaa  12768400
                                                                                     <---------AHL25(3)
                                                                                     <---------AHL20(2)
                                                                                     --------->AHL25(1)
                                                                                     --------->AHL20(2)
                                                                                     <---------AHL25(1)
                                                                                    --------->AHL25(3)
                                                                                    <---------AHL20(2)
                   <---------AHL25(3)                                              <---------AHL12(2)
                   <---------AHL20(3)                                            <---------AHL12(1)
                   <---------AHL25(2)                                            --------->AHL20(2)
                   <---------AHL12(2)                                            --------->AHL12(1)
                   --------->AHL25(2)                                           <---------YAB1
                   --------->AHL20(1)                                           --------->AHL25(3)
                   --------->AHL20(3)                                          <---------AHL12(2)
                   <---------AHL20(2)                                          <---------AHL25(2)
                  <---------AHL25(2)                                           --------->AHL12(2)
                  <---------AHL25(3)                                           --------->AHL20(3)
                  <---------AHL20(2)                                           <---------AHL12(3)
                  --------->AHL20(2)                                           --------->AHL12(3)
                  --------->AHL12(3)                                           <---------AHL20(3)
                  <---------AHL12(3)                                           --------->AHL25(2)
                  --------->AHL25(3)                                          --------->YAB5
                  <---------AHL25(1)                                          -------->ATHB1
                  --------->AHL25(1)                                          --------->ATHB51
                  --------->AHL25(2)                                          --------->YAB1
                  <---------AHL12(1)                                          <---------ICU4
                  --------->AHL12(1)                                          <--------HAHB4
                 --------->AHL25(1)                                          --------->AHL25(3)
                 <---------AHL25(1)                                          <---------AHL12(1)
                 --------->AHL25(2)                                          <---------YAB5
                 <---------AHL25(2)                                          --------->ICU4
                 --------->AHL25(3)                                          --------->AHL12(1)   <-
                 --------->AHL12(1)                                       --------->AHL20(2)     <--
                 <---------AHL12(1)                                     --------->WOX13(2)       <--
                 <---------AHL20(2)                                  --------->AHL25(2)         ----
                 --------->AHL12(3)                                  --------->AHL20(2)         ----
                 <---------AHL12(3)                                  --------->AHL25(1)        <----
                --------->AHL25(2)                                   <---------AHL25(1)        -----
                --------->AHL20(3)                                   <---------AHL20(3)      <------
                <---------AHL25(2)                                  --------->YAB1 --------->AHL12(2)
                --------->AHL12(2)                                  --------->AHL12(2)       -------
               <---------ICU4                         <-----------GT1<---------AHL20(2)      -------
            --------->YAB1                          <---------AHL25(1)  <---------TOE2(3)<---------AHL20(2)
        --------->MYB46(3)                          <---------AHL20(2)  <---------WOX13(2)  <-------
 
gcccatttagaaccatcaaaattattttgacccatataaactcatttagacctatttaaaccatatgtgaattttaatgaattattatttatttgattat  12768500
       <---------AHL20(2)
      --------->AHL20(2)
    --------->TOE2(3)
   --------->YAB5
  <---------YAB1                                                           <---------AHL20(2)
 <---------ARR11(3)                                                        --------->AHL20(2)
 --------->ARR11(3)                                                        --------->AHL20(3)
--------AHL12(2)                                                           --------->AHL25(2)
-------AHL20(2)                                                            --------->AHL25(1)
-------AHL25(3)                                                            --------->AHL25(3)
----->AHL20(2)   --------->WOX13(2)                                        <---------AHL25(2)
----->AHL25(3) <---------AHL20(2)                                     <---------YAB5
-----AHL12(2)  <---------AHL25(1)                                    --------->ANAC58
---->AHL12(2)  --------->AHL25(1)                     <---------AHL12(1)   <---------AHL20(1)
---AHL12(1)    <---------YAB1                   --------->TOE2(3)    --------->ANAC58      ---------
-->AHL12(1)    --------->AHL20(2)               <----------DOF2 <---------TOE2(3)    --------->ANAC46
-->AHL20(2)--------->YAB1          <---------YAB1     --------->AHL12(1)   <---------AHL25(1)
--YAB1<---------AHL25(1)         --------->YAB1 --------->TOE1(3)  <--------P   <-----------GT1
 
ttaatatcattaaatcatataattgcgaaatcacaaacatcatagcataaactttaaaatttcacttgaggtaagcattttattttccacaatacaaagt  12768600
<- Previous    Next ->

AGI:  At4g24770.1   
Description:  RBP31 (31-KDA RNA BINDING PROTEIN); RNA binding / poly(U) binding. Identical to 31 kDa ribonucleoprotein, chloroplast precursor (RBP31) [Arabidopsis Thaliana] (GB:Q04836;GB:P92871;GB:Q03394;GB:Q43350); similar to 31 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein RNP-T, putative / RNA-binding protein 1/2/3, putative / RNA-binding protein cp31, putative [Arabidopsis thaliana] (TAIR:AT5G50250.1); similar to RNA-binding protein precursor [Persea americana] (GB:CAD18921.1); contains InterPro domain RNA recognition motif, RNP-1; (InterPro:IPR000504); contains InterPro domain Nucleotide-binding, alpha-beta plait; (InterPro:IPR01
Range:  from: 12766040    to: 12768050    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version