AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                  <---------KAN1       <---------ZAT14         --------->At4g35610
       ------------>MYB.PH3(2)         <---------ZAT18         <---------At4g35610
  --------->YAB5 --------->GLK1(2)     --------->ZAT18        <-----------RAV1(1)
 --------->ICU4 <---------GLK1(2)     <---------KAN1       --------->ARR11(2)      <<<<<<<<<TBF1
----->GT1 <---------MYB46(3)      <---------KAN1  ------>ZmHOX2a(1)             <<<<<<<<<TBF1      -
taacatgatgagtttgttagaatctctttgaagacgaacgagtgaacaaactcctaaggctgtttctgctgtctctagttttcttcttcttcatcttctt  12744900
         --------->At4g35610                                                           <------ZmHOX2a(2)
        --------->RVE1(2)                                                              --------->PCF2
    <---------ICU4                                                                    <---------GATA12
    --------->YAB5                                                                    --------->ARR11(2)
    --------->YAB1                                                                    --------->GATA12
    <--------HAHB4                                                                    <---------ARR11(2)
   <---------YAB1                   ---------->DOF2                                   <---------ARR14(2)
   --------->ICU4            ---------->ID1                <---------ANAC46       <---------TOE1(2)
   <---------YAB5          <---------MYB46(3)           <---------GLK1(2)  --------->GLK1(2)
   <---------ATHB12        --------->KAN1       <---------ANAC58          <---------GLK1(2)        <
----->NtERF2           <---------HSFB2a(1)      <---------ANAC58      ---------->DOF2 --------->ARR14(2)
gaggccatcattatctgaagaagagaaggtttgttcttctaaagtgagttcgcgttccagtttcttagagaccgaaagaatctcgtagggatcccacagc  12745000
       <---------KAN1                  <---------ANAC46
      --------->GLK1(1)                <---------ANAC58
      <---------ARR14(2)              <---------LBD16         --------->ANAC55(2)
      --------->ARR14(2)           <----------DOF2  <---------ANAC58
      <---------GLK1(1)      <---------KAN1<---------KAN1     <---------ANAC55(2)
->RAV1(1)              --------->MYB52(1)------>NtERF2<---------MYB52(1)           ---------->DOF2
---------KAN1--------->RVE1(2)--------->YAB5        <---------ANAC58        <----------DOF2 <-------
gactgtccgaattcccaatccaaaaacgacggatgatgctttgcggacaaggcttccgttttgaaacgtgatgccttccctttgacaaaagcatgctttc  12745100
                                         <---------MYB46(3)  <---------ATERF1(1)
                                        --------->ALFIN1  --------->LBD16                         <-
                                      --------->ALFIN1   --------->ANAC46           <---------------
                                --------->ALFIN1       <---------ATERF1(1)       <------------------
--------->ANAC46             <---------TOE1(3)     --------->ANAC58        --------->ZAT6        ---
---DOF2  --------->ZAT6      <---------TOE2(3)     --------->ANAC58  --------->REM1(1)   <<<<<<<<<TBF1
tctgcgcatcgaactctaaaacagtatgttttgaggtttgggagtggctgagccaagcctgcgcagctgccttcatcaactctagtctcttcttcttctc  12745200
      <<<<<<<<<TBF1                                                               <---------ARR14(2)
   <<<<<<<<<TBF1                                        <<<<<<<<<TBF1             --------->GATA12
--------DOF5.7(1)                               <------------------------ANAC81   <---------GATA12
---------ANAC81                 <---------CCA1(2)    <<<<<<<<<TBF1            <---------LBD16    ---
------ANAC81        <----------DOF2        <---------CCA1(2)              <----------DOF2        <--
--->ZmHOX2a(1)     <---------DOF5.7(1)  ------>ZmHOX2a(1)    <-----------------AGL1<------ZmHOX2a(2)
ctcttcttcttcttcattttcatctttagcctctcgtttcttcctcatctctcttcttcttcttctccattttgggacttttggggatccaagtcttatt  12745300
                                   <---------KAN1                                                  -
                                  --------->ARR11(2)                                               -
                                  <---------ARR11(2)                                               <
                                  --------->GATA12                                                 <
                                  ------->TEIL                                                    --
                                  <-----------ARR10                                               <-
                                  <---------ARR14(2)                                             ---
                                  --------->ARR14(2)                                           -----
                                  <---------ARR11(1)                      <----------DOF2      -----
          <-----------HVH21       --------->RVE1(2)                      <---------DOF5.7(1)   <----
  ----------->GT1        <---------ANAC58                     <---------ANAC58                <-----
 <---------TOE2(3)       <---------ANAC58                     <---------ANAC58               <------
 <---------TOE1(3)       <---------ANAC46                <---------At4g35610                 -------
-------YAB1           *TSS --------->KAN1         <---------ANAC58---------->ID1  <----------DOF2<--
------>ANAC55(2)--------->TOE2(3) <---------GATA12<---------ANAC58<---------CCA1(2)   <----------DOF2
-------ANAC55(2)--------->TOE1(3)<---------ARR14(1)      --------->At4g35610     <---------DOF5.7(1)
atgtaaggtttaatgtcagccttaagtttcttgttcgaatctactcacttctgtcttgtcttctgtcttgtctcttccttttcatctttctttgtttatt  12745400
---------AHL12(3)                                                                    <---------MYB46(3)
-------->AHL12(1)                                                                   <--------P
---------AHL25(3)                                                                  <---------ANAC58
-------->AHL25(1)                                                                  <---------ANAC58
-------->AHL12(3)                                                              <---------ANAC46
---------AHL25(1)                                                              <---------ANAC58
---------AHL12(1)                                                         --------->At4g35610
------->AHL25(3)                       <---------At4g35610              <-----------RAV1(2)
--------AHL20(2)                <---------GLK1(2)                      <------ZmHOX2a(2)----------->HVH21
------>AHL12(2)                 <---------GATA12                      --------->RVE1(2)<---------ANAC46
---->AHL20(2)                   --------->ARR11(3)                    --------->GATA12--------->At4g35610
---->AHL12(1)                   --------->GATA12                 --------->MYB52(1)<-------GAMYB
-----AHL12(1)                   <---------RVE1(2)        --------->AHL20(2)    <---------ANAC58
----YAB1                        <---------ARR11(3)       <---------AHL25(3)    <---------bZIP60(2)
---AHL12(2)                <----------DOF2--------->YAB5--------->AHL20(2)<---------At4g35610
-->AHL12(2)               <---------DOF5.7(1)         --------->YAB1  <---------GATA12<---------At4g35610
-------AHL12(2)<---------DOF5.7(1)     --------->At4g35610    <---------AHL12(2)  <---------MYB46(3)
atttattttcatgcctcgttttttcttagcctttagattttcagatgacaaaaacaaaaataaaaaaaaaacagatcagatgacttggttgctgacaatt  12745500
         <---------AHL20(2)                            ----------->GT1
       <---------WOX13(2)                          --------->DOF5.7(1)
       --------->WOX13(2)                         <---------TOE2(3)       --------->At4g35610
    <---------YAB1                               ---------->DOF2          ----------->RAV1(2)
   --------->RVE1(2)                         ----------->GT1              <---------At4g35610
 --------->ICU4                             <---------ARR11(3)           <---------GATA12         --
<---------WOX13(2)     <---------MYB52(1)   --------->ARR11(3)<-----------------AGL1          ------
--------->WOX13(2)  <-------TEIL          <---------RVE1(2)  <-----------GT1          --------->YAB5
gttcattatcaatttatcatcgattcgtttattgtcaacaatttagagatgttaaagatggtaataacccattgggcatctgaagcccatgtttaatact  12745600
                <----------DOF2 --------->AHL20(2)
             <---------ARR11(2) <---------AHL20(2)
       ------>ZmHOX2a(2)        --------->AHL20(3)
      <---------At4g35610       <---------AHL25(1)
      --------->At4g35610       <---------AHL25(3)
     <---------GATA12           <---------AHL20(1)
     --------->GATA12           <---------AHL25(2)                                         ---------
     <---------ARR11(3)       <---------AHL12(2)       --------->YAB1                     --------->YAB5
     <---------RVE1(2)       --------->YAB1            <---------ICU4                <---------YAB5
   ----------->HVH21        <---------AHL12(1)        <---------YAB1           --------->YAB5
  --------->LBD16          --------->AHL20(2)         <---------YAB5          --------->ICU4
  <-----------HVH21        --------->AHL20(3)       --------->YAB1            ----------->GT1
 <---------ANAC55(2)       --------->AHL25(2)       --------->REM1(1)         <---------ANAC46  ----
 --------->ANAC55(2) --------->YAB1       <---------KAN1   --------->At4g35610<---------YAB1 -------
------>P  <---------ANAC58 <---------AHL20(3)    <---------DOF5.7(1)--------->YAB5<---------AHL20(2)
--->ANAC46<---------ANAC58 <---------AHL25(2)<-----------GT1     <---------At4g35610--------->WOX13(2)
caacccgtgatctgcgtttctttatcacaaaataataaaatgagcattttccccttcatcatagctgtagatgatgaagtgatgtttaatcaacaattag  12745700
                                                                   <---------MYB46(3)              -
                                                                  <--------P                       -
                                                               <---------TOE1(3)                  <-
      <-----------GT1                                      --------->WOX13(1)                     <-
>WOX13(2)                                  <---------bZIP60(1) <---------TOE2(3)        --------->At4g35610
----->YAB1                   <---------YAB1--------->bZIP60(1)<-----------RAV1(2)       <---------At4g35610
-->YAB1       ----------->RAV1(1)        <-----------GT1 <---------YAB5                XXXXXXXXXXXXX
cataacatttttctgaacaacacaacttcattgttatttgtttatgacctcacaaaaatggtcattcaggttgttcagacttctctctcttagctgtttc  12745800
<- Previous    Next ->

AGI:  At4g24700.1   
Description:  unknown protein
Range:  from: 12744632    to: 12745323    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At4g24710.1   
Description:  ATPase. similar to CDC48B, ATPase [Arabidopsis thaliana] (TAIR:AT2G03670.1); similar to unknown [Populus trichocarpa] (GB:ABK94553.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO64241.1); contains InterPro domain AAA ATPase, conserved site; (InterPro:IPR003960); contains InterPro domain Chaperonin clpA/B; (InterPro:IPR001270); contains InterPro domain AAA+ ATPase, core; (InterPro:IPR003593); contains InterPro domain AAA ATPase, core; (InterPro:IPR003959)
Range:  from: 12745557    to: 12749005    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version