AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
     ------>MYB83                                                                                  <
   <---------MYB59                                                                                <-
<-----------GT1                             --------->ANAC58                                      --
-------WOX13(2)                         <-----------HVH21          <----------DOF2              <---
------>WOX13(2)                         --------->TOE2(3)  <---------ANAC58                    -----
---->GT1         <---------DAG2        --------->ANAC46    <---------ANAC46                 <-------
->MYB59          <----------DOF2   <---------YAB5          <---------ANAC58          <-----------GT1
--AGL15       <---------ALFIN1     <---------KAN1     --------->ICU4         <---------TOE1(2)------
---AG------>MYB46(1)           --------->LBD16        <-----------RAV1(1)   ------>ZmHOX2a(1)<------
---AGL1    <-----------GT1   <---------LBD16--------->ANAC58    <-----------GT1 <---------MYB52(1)--
 
aataaacctaacattcaccactttaagtccaaaccggaatcaacgtcaagctatgtaatgttgcttatttctttatgtccttcgtttgtaacatttcccg  12564600
               --------->ARR11(2)
               --------->ARR14(2)
               <---------ARR11(2)
     --------->ZAT14
     <---------ZAT14    <-----------GT1
<---------ARR11(2)   --------->ARR14(2)                                           <---------ANAC58
-------GAMYB   <---------ARR14(2)                                               <---------YAB1
--------MYB46(3) ------>ZmHOX2a(2)                      --------->TOE2(3)      --------->KAN4(2)
--------->GT1  --------->GATA12              <---------SPL7(1)                --------->KAN1
------MYB52(1) <---------GATA12           --------->At4g35610              <------MYB83
---->LBD16   <---------DEAR3(2)        <---------At5g28300                 ----------->GT1       ---
--LBD16     --------->ETT(1)------>NtERF2 <---------At4g35610 <-----------RAV1(1) <---------ANAC58
--->LBD16 <-----------HVH21<---------ANAC46--------------->AtSPL3          <------MYB46(1)       ---
---LBD16 <-----------RAV1(1)<---------RAP2.6(3)--------->SPL7(1)       <---------RVE1(2)   <-------GAMYB
------->MYB55(2)<------ZmHOX2a(2)     <-----------GT1 <---------GATA12--------->ATHB12    <---------MYB46(3)
 
gtggttactactctgtcggatccagttttgccgtctagtttttacagcggtacgataaatctcaaatgttgtttgatttggttattcttgcgatggttag  12564700
                                                                                            <-------
                                                                                           ---------
                                                                                         <--------HAHB4
                                                                                         -------->ATHB1
                                                                                         <---------ICU4
                                                  --------->YAB5                         --------->YAB5
                                                  <---------ICU4                         --------->YAB1
           <---------GATA12                    --------->ANAC46                         --------->ICU4
           --------->GATA12            --------->ANAC58           <---------ALFIN1      <---------YAB5
 --------->WOX13(2)                    --------->ANAC58           --------->AtMYB61    --------->GLK1(2)
 <---------WOX13(2)         <---------ZAT6  <---------REM1(2) --------->MYB46(3)   --------->YAB1  -
------>TOE2(3)             <---------WOX13(1)<---------ALFIN1------->TEIL------>ZmHOX2a(1) <--------
------>TOE1(3)  <---------ANAC46       --------->ANAC46  --------------->AtSPL8  --------->RVE1(2)--
 
ccttaatttcgctagatttatgtgtatttgagtgatagctacaagcctacacatcattaccatgtaccaccatctccttattcaaatcagaatcattatc  12564800
                                                                                                   <
                                                                                                   <
                                                                                                   <
                                                                                               <----
                                                                                             <------
                                                                                        <---------AHL20(2)
                                                                                        --------->AHL20(2)
                                                                                      <---------AHL12(2)
                                                                                     <---------AHL12(3)
                                                                                     --------->AHL25(1)
                                                                                     --------->AHL20(2)
                                                                                     <---------AHL20(2)
                                                                                     --------->AHL20(1)
                                                                                     --------->AHL25(2)
                                                                                     <---------AHL25(1)
                                                                                     <---------AHL12(1)
                                                                                     <---------AHL25(3)
                                                                                     <---------AHL25(2)
                                                                                     --------->AHL12(1)
                                                                                    <---------AHL20(2)
                                                                                    --------->AHL12(3)
                                                                                    --------->AHL25(1)
                                                                                    <---------AHL12(3)
                                                                                    --------->AHL20(2)
                                                                                    <---------AHL25(2)
                                                                                    --------->AHL25(2)
                                                                                    <---------AHL25(1)
                                                                                    <---------AHL12(1)
                                                                                    <---------AHL25(3)
            ---------->ID1                                                          --------->AHL12(1)
            <---------YAB5                                                          --------->AHL25(3)
   --------->MYB46(3)                           --------->YAB5                     <---------AHL25(2)
 <---------ARR14(2)                             --------->YAB1                     --------->AHL20(2)
 <---------ARR11(2)                             <---------ICU4                     --------->AHL12(2)
 --------->ARR11(2)                            --------->ICU4                      --------->AHL25(3)
 --------->ARR14(2)                          --------->YAB1                        <---------AHL20(1)
--ICU4 <---------DAG2             <---------DEAR3(2)           --------->ALFIN1    --------->AHL20(3)
>ICU4  <---------DOF5.7(1)      --------->DDF1 <---------KAN1  <---------REM1(1)   --------->AHL25(2)
-------->At5g28300   <---------DOF5.7(1) ---------->DOF2  --------->DOF5.7(1)      <---------AHL20(3)
-YAB1  <----------DOF2        <-----------RAV1(1)  --------->AHL20(2)       <---------WRKY38(1)<----
------->ANAC46      <----------DOF2  ---------->DOF2    ---------->DOF2--------->DOF5.7(1)   -------
 
gccgtaaccacttttgtcattttctttttttatatgtcggtaaagaaagaataatgaaataaagaggtgtaagtaagagtcaacaaaataatttaagagc  12564900
      ----------->GT1
    <------------CBF
    <---------WOX13(2)                            <---------AHL12(2)
---------ANAC46                                 --------->AHL20(2)          --------->ARR11(3)
---------ANAC58                                 <---------AHL20(2)          <---------ARR11(3)
---------ANAC58                                 <---------AHL25(3)      ---------->DOF2
-----ANAC58          <---------DOF5.7(1)       --------->AHL20(3) --------->YAB5
---ARR11(3)          <----------DOF2<-----------TBP   *TSS        --------->ATHB12           <------
-----ANAC58         <---------DOF5.7(1)        <---------AHL20(3)<---------YAB5     <-----------GT1
-->ARR11(3)        <---------DOF5.7(1)         <---------AHL12(3)<---------KAN1     --------->ANAC46
 
ttgtgtgaattgataaaaacactccttttctgttcttggttttatatgaaatttataaacaaactcgagtgattacaaagaacttataaaccacttatgt  12565000
                                                                                         <---------AHL12(2)
                                                                                         --------->AHL12(2)
                                                                                         --------->AHL20(3)
                                                        <----------DOF2                  <---------AHL20(3)
                                                       <---------DOF5.7(1)              <---------AHL25(2)
                                                      <-----------------AGL1            --------->AHL25(2)
                                                      <-----------------AG             <---------CCA1(1)
                                            <---------ARR14(3)                         <---------RVE1(1)
                   --------->AHL20(2)       --------->ARR11(3)                        <---------ARR11(3)
                   <---------AHL12(3)       <---------ARR14(2)                        --------->ARR11(3)
                   --------->AHL25(2)       <---------ARR11(3)                    ---------->DOF2
                   <---------AHL25(1)       --------->ARR14(3)                 <---------At4g35610
         --------->AHL20(2)                 <---------GATA12                   --------->At4g35610
        --------->AHL12(2)                  <---------RVE1(2)      --------->At4g35610<---------RVE1(2)
        <---------AHL12(2)                  <---------GLK1(2)      <---------At4g35610--------->AHL20(1)
-----RAV1(1)       <---------AHL25(2)     ----------->ARR10       --------->DOF5.7(1) <---------AHL20(1)
 
ggcatactaaaatttaacaaaaaaaaatgttttgcgaaaaataagaagattttgttcatcttttttggtaagatgccagtttagctaaagatatttttca  12565100
                                         --------->ANAC58
                                         --------->ANAC55(1)
                                         --------->ANAC58
                                       <---------ALFIN1
             --------->YAB1           <---------REM1(2)
       --------->YAB5                <---------ALFIN1                 --------->MYB46(3)
       --------->YAB1             --------->ANAC46                    --------->ANAC58
    <---------ICU4                --------->ANAC58                    --------->ANAC58
  <---------AHL20(3)              --------->ANAC58            <---------ANAC58
  --------->AHL20(3)        ----------------------->TaNAC69(2)<---------ANAC58
  <---------AHL20(2)       --------->DOF5.7(1)              <---------AHL20(2)              <-------
<---------AHL20(2)       ---------->DOF2 --------->ANAC46   <-----------GT1       --------->ANAC46
 
tatataaaaatgacaataaacacattacaaaagacaaaccccacacggctctctctagccaaattacttggccacgaccataaacacaaaacaccgctta  12565200
                                                        >>>>>>>>>AtERF-3
                                             <---------RAP2.3(1)
                                             ------>NtERF2
                                           --------->ATERF1(1)
                                           <------NtERF2>>>>>>>>>AtERF-4
                                          <---------ATERF1(1)
                                         --------->ALFIN1------>NtERF2
                                       --------->At4g35610
                                       <---------At4g35610                                      ====
                                  --------->MYB55(2)   --------->ATERF1(1)                      ----
                                  <---------MYB46(3)  --------->At4g35610                      -----
                                 <---------AtMYB61    <---------At4g35610                      -----
                               <------MYB83--------->RAP2.3(1)                              --------
                               <------MYB46(1)<------NtERF2    --------->At5g28300          <-------
                              <---------AtMYB61--------->DEAR3(1)                           <-------
                              --------->ALFIN1--------->ATERF1(1)  <---------WOX13(2)       --------
                 ----------->GT1 --------->ALFIN1     --------->ZAT2                        --------
                --------->HSFB2a(2)  --------->ZAT18  <---------ZAT2                       ---------
     --------->RVE1(2)        --------->MYB55(2)      <---------ATERF1(1)                  <--------
     <---------GATA12         --------->MYB111(2)    <---------ARR14(2)                  --------->YAB1
     --------->GATA12         --------->MYB111(1)    --------->ARR14(2)                 <---------ATHB12
     --------->GLK1(2)        <---------MYB46(3) <---------------------WRI1       ==================
 --------->HSFB2a(2)  --------->DOF5.7(1)<---------DEAR3(1)   ----------->GT1     ------>ZmHOX2a(1)
---CDC5         <---------HSFB2a(2) <---------ANAC46 --------->ARR11(2)           ==================
 
gcttctaaaatctgaacatcgagaaaaaatgagttggtggtgggctggcgccatcggagctgccaaggtaaatttcaattcaatccttcaaatcatatcc  12565300
  ------>ZmHOX2a(2)
 <------ZmHOX2a(2)
<---------GATA12
--------->GATA12
<---------RVE1(2)
<---------ARR11(3)
<---------ARR14(2)
--------->ARR14(2)
--------->ARR11(2)
<---------ARR11(2)
--------->ARR11(3)
=========HOX2a_HOX2a
-->ZmHOX2a(1)
---->TOE1(2)
---->TOE2(2)                              --------->ZAT18
->ARR11(2)                                --------->ZAT14
--ARR11(2)                                <---------ZAT14
--ARR14(2)                                <---------ZAT18
->ARR14(2)                          --------->WOX13(2)                                  <---------HSFB2a(2)
->RVE1(2)         <---------WOX13(1)<---------WOX13(2)                             <---------HSFC1(2)
>KAN1           --------->ATHB12  <---------AHL20(2)                               --------->HSFC1(2)
-CCA1(2)     <---------At4g35610  --------->AHL20(2)                            ---------->DOF2
========HOX2a_HOX2a             <----------DOF2                          --------->MYB46(3)
=========HOX2a_HOX2a        <---------CCA1(2)      --------->At4g35610  ------->TEIL    --------->HSFB2a(2)
 
tccgatcttcatcttcaactgattgaaaatcatctctttaatttgtgtactcgcagaagaaactcgacgaagatgaaccatcacaaagcttcgagagcgt  12565400
                                              --------->GLK1(2)
                                             <---------GLK1(2)
                                             --------->ARR14(2)
                                             <---------GATA12
                                             <---------ARR14(2)
                                             <---------RVE1(2)
                                             --------->GATA12          <---------AtMYB61
                                            --------->KAN1             --------->ALFIN1       <-----
                                            --------->GLK1(1)        --------->LBD16         ------>NtERF2
              <---------ARR11(2)            --------->HSFB2a(1)    <---------LBD16           <------
            <----------DOF2                ----------->ARR10    <---------ALFIN1             <------
            <-----------HVH21             <------NtERF2       <---------ALFIN1              <-------
        <---------DEAR3(1)        --------->ZAT2       <----------DOF2<---------MYB52(1) --------->ANAC46
     <---------ICU4          <---------ARR11(2)      <---------DOF5.7(1)<---------MYB46(3)  --------
     --------->ATHB12        --------->ARR11(2) <-----------GT1 --------->KAN1           <---------DEAR3(1)
    <---------YAB1    <---------YAB5    <---------ANAC46   --------->ANAC46             <---------LBD16
    <---------YAB5    <---------HSFB2a(1)--------->LBD16   <---------ETT(1)      ---------->DOF2
  --------->YAB1 --------->HSFB2a(2)   <---------LBD16<---------DOF5.7(1)     --------->AtLEC2------
 
cgctctcatcatcggcgttactggaatcgtcggaaacagcttggcggagattctccctctttccgacacacccggtggtccatggaaagtctacggcgtc  12565500
<- Previous    Next ->

AGI:  At4g24220.1   
Description:  VEP1 (VEIN PATTERNING 1); binding / catalytic. similar to wound-responsive protein-related [Arabidopsis thaliana] (TAIR:AT5G58750.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN63254.1); contains InterPro domain NAD(P)-binding; (InterPro:IPR016040)
Range:  from: 12564955    to: 12566765    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version