AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
           --------->GLK1(2)                    <---------AHL25(2)<---------ARR11(2)
           --------->ARR11(3)                   --------->AHL12(1)--------->GATA12
  --------->ANAC58                              <---------AHL12(1)--------->RVE1(2)                <
  --------->ANAC46       <-------TEIL     <---------WOX13(2)    ------>ZmHOX2a(1)  --------->ANAC58-
  --------->ANAC58<-----------GT1         --------->WOX13(2)  ----------->RAV1(2)  --------->ANAC58-
-----YAB5  --------->RVE1(2)        <---------YAB1<---------AHL25(3)            <---------SPL7(1)  <
--YAB5     <---------ARR11(3)   <---------RVE1(2)--------->AHL25(1) ------>ZmHOX2a(2)       --------
cgtagacgacacaaaatctttgaaccggttcatttgattttgatcaattgaaatatttccgttcatcctgatccatgctccatcgtatgcaagggtcgag  12159900
               <---------ARR11(2)                --------->GLK1(1)
       <-----------HVH21                        <---------GATA12
  --------->GLK1(2)                             <---------GLK1(2)
 <---------ARR14(2)                          --------->ANAC58
 --------->KAN4(2)                           --------->ANAC58
--------->AHL12(1)                           <---------ANAC55(2)
--------->HSFB2a(1)                          --------->ANAC46
<---------AHL12(1)                           --------->ANAC55(2)
<---------HSFB2a(1)                    --------->AHL20(2)
--------->KAN1 --------->RVE1(2)       <---------AHL20(2)                                          -
<---------KAN1 <-----------ARR10    --------->YAB1       --------->KAN1           <-------GAMYB   <-
--------->KAN4(1)                  <---------YAB1<---------KAN1                  <---------MYB46(3)-
<---------KAN4(1)                <---------ICU4 --------->ARR14(2)               <---------ANAC46 --
---------ARR14(2)                --------->YAB1 <---------RVE1(2)           <---------KAN1       <--
--------->TaMYB80               <---------YAB5  --------->ARR11(2)          --------->ALFIN1     ---
-------->ARR14(2)               <---------YAB1  <---------ARR14(2)   --------->ZAT14            ----
---------KAN4(2)              --------->YAB1 --------->ANAC55(1)   --------->ANAC58             <---
->ETT(2)      <---------KAN1--------->ANAC46<---------LBD16        --------->ANAC58          -------
agaatattctggtcagagtatctgagcatacactcatcataataaaacacggattttctctcactcggacactgaacgagtgtgtcgttgatggagaagg  12160000
       <----------ID1        <---------ARR14(2)
       --------->ANAC58      <---------ARR11(2)
       --------->ANAC58      --------->ARR11(2)
    --------->ARR11(2)    =======================bZIP_DOF
    <---------ARR11(2)    =======================bZIP_DOF
    --------->ARR14(2)    --------->O2
    <---------ARR14(2)    <---------TGA1a            ----------->HVH21
-------->ANAC58           --------->TGA1a           <---------MYB52(1)      ------>NtERF2
-----NtERF2               <---------O2       --------->DAG2   <-----------RAV1(2)
-------->ANAC58     <-----------HVH21        --------->DOF5.7(1)    <---------ANAC46
------->ATERF1(1)  --------->LBD16 --------->LBD16 --------->LBD16  <---------ANAC58
-------ATERF1(1)  --------->ATERF1(2)       ---------->DOF2 <-----------HVH21 ----------->RAV1(2)
--->NtERF2        <---------ATERF1(2) ---------->DOF2--------->WRKY38(1)   --------->ANAC58
------->HVH21     <---------DEAR3(1)<------NtERF2  <---------At4g35610     --------->ANAC58
------DEAR3(1)  --------->MYB52(1)--------->ANAC46 --------->At4g35610 <-----------HVH21           -
-->DOF5.7(1)--------->MYB52(1) <---------LBD16   <---------LBD16    <---------ANAC58  <----------DOF2
cgacgcagttacgacaaactgccggtgagacgtctccgcggcaaaggaaaagtccggtgactctatcaggggcttgtcccgccctggcgctttggaatcc  12160100
               <---------ANAC58                                      <---------ANAC58            ---
             --------->ALFIN1                                        <---------ANAC58           ----
            --------->ALFIN1                                         <---------ANAC46           <---
          <---------ANAC58                                      <---------MYB46(3)              ----
          --------->ALFIN1                                 --------->DOF5.7(1)        --------->ARR14(2)
          <---------ANAC46          --------->DOF5.7(1)   --------->MYB52(1)          <---------ARR14(2)
          <---------ANAC58   <----------ID1            --------->ANAC58            <---------ANAC58
     --------->DOF5.7(1)--------->DOF5.7(1)            <---------ANAC55(2)         <---------ANAC46
 <---------ZAT6<---------ANAC46    --------->DOF5.7(1) --------->ANAC58            <---------ANAC58
-------->ZAT14<---------MYB46(3)  ---------->DOF2      --------->ANAC55(2)        ---------->ID1<---
agtagagtaagaggcgttgggggcagaaagagaagacaaaagggttctgagattagtcaagtaagggctgtttcttgaataagttgtcgtatttgggcaa  12160200
  --------------->AGL15                                                        *TSS
  <----------DOF2                                                         <------NtERF2          ===
 <-----------------AGL3                                      --------->At4g35610   <------------CBF
------>KAN1                                             --------->DOF5.7(1)<-----------RAV1(2)   ---
----->ARR11(2)               --------->At4g35610       --------->DOF5.7(1)--------->At4g35610   ----
------ARR11(2)               --------->ZAT2           ---------->DOF2    ----------->RAV1(1)<-------
----->ARR14(2)              --------->GLK1(2)     >>>>>>>>>TBF1    --------->DOF5.7(1)     ---------
------ARR14(2)           ------->GAMYB        <------ZmHOX2a(1)  ---------->DOF2 --------->ARR11(3)
atatgctttatatagaaaacattttcaacagaagctgtgaagctagtgaggaagaagaaaaggaagatgaaagaggcaccagaagacattgttcgatttc  12160300
                    <---------GATA12--------->YAB5                         <---------WOX13(1)
               --------->YAB5<---------YAB5<-----------GT1                <---------ARR14(2)
              <------ZmHOX2a(2)<---------AHL20(3)                         <------------CBF
             <---------ARR11(3)<---------AHL12(2)            <---------ANAC58
             <---------RVE1(2)--------->AHL12(1)             <---------ANAC55(1)
             <---------GATA12<---------ATHB51                --------->ANAC55(2)
  <----------DOF2<---------YAB1--------->AHL20(3)            <---------ANAC46
<---------At4g35610 ------->TEIL --------->YAB1              <---------ANAC55(2)               -----
=====================HOX2a_HOX2a<---------YAB1               ----------->GT1       --------------->AGL15
--->ZmHOX2a(1)===================HOX2a_HOX2a                 <---------ANAC58      <---------------AGL15
----->TOE2(3)--------->GATA12--------->AHL25(3)<<<<<<<<<TBF1 <---------O2<------ZmHOX2a(1)     <----
--GLK1(1)    --------->ARR11(3)<---------AHL25(2)         <---------MYB52(1) --------->YAB5  <------
>GATA12     <---------At4g35610--------->AHL25(2)        <-----------HVH21--------->ARR14(2) <------
ctcagcttttgtttcagatcatgaatctcctaattattatgaatattttcttcttctctctgttacgtgaaacagaggattgactactactataagtcaa  12160400
                                                                        <---------YAB1      --------
       <----------DOF2                                              <---------ANAC58        <-------
      <---------DOF5.7(1)                                   --------->ARR11(3)              --------
     ---------->ID1                           ---------->DOF2       <---------ANAC46       <--------
<----------DOF2                    ----------->GT1          <---------ARR11(3)             <--------
---->At4g35610           --------->ANAC58   <---------YAB1  <---------GLK1(2)   --------->CCA1(2)  -
-----At4g35610           --------->ANAC58 --------->YAB1    --------->GATA12 --------->ANAC58-------
---WRKY38(1)             --------->ANAC46<---------YAB1     <---------RVE1(2)--------->ANAC58-------
---WRKY12       ----------->GT1<------ZmHOX2a(1)      --------->YAB5<---------ANAC58     --------->YAB1
ctgcttttgtctttttaagtgggaaaacaagacaggaagagtttataatgaaagtgaccattagatttttggcttatgaaaagctatgcatattatcatt  12160500
->YAB1               --------->KAN1                       --------->ANAC58
-HAHB4           <------ZmHOX2a(2)                        --------->ANAC46
->YAB5          --------->ARR11(3)                  --------->ANAC58
-YAB5           <---------ARR11(3)       <---------YAB1 --------->MYB52(1)
-YAB1 --------->TOE2(3)        ------>ZmHOX2a(2)    --------->ANAC58
-------->TOE2(3)--------->RVE1(2)       --------->TOE2(3) --------->ANAC58
-->TOE2(3)      <---------GATA12      <---------YAB5--------->ANAC46          <-----------RAV1(2)
-->WOX13(2)     --------->GATA12   <-------TEIL<----------ID1            --------->ANAC46
aacctctaatctcaacgaagatcaacactcgtgatcgatgcatcatcaatggaacaagcaaacgacatggtagtagacggaccaggctcaagtctctcgg  12160600
              <---------ARR11(2)         --------->WOX13(2)                                  <------
              <---------AGP1             <---------WOX13(2)                     --------->At4g35610
              --------->ARR14(2)     --------->ANAC46                           ====================
              <---------RVE1(2)     --------->LBD16                             ----------->RAV1(2)
              <---------ARR14(2)   <-----------RAV1(2)                          <---------At4g35610
              --------->RVE1(2) <---------ARR14(2)      <------NtERF2      <---------ZAT18   -------
              <-----------ARR10 --------->RVE1(2)  <-------PIF5       <---------YAB1         <------
             <---------CCA1(2)  --------->ARR14(2) ------->PIF5 ---------->DOF2<---------GATA12<----
         <---------ANAC46       <---------GATA12  <XXXXXXXXXXXXXXXXXXXXXMIR472 --------->GLK1(2)   <
ctaatgggtttggctcggatctgaccctgaaaacaaatccaggtaattgaggcacgggcagagtaagaaaagtattagtgagcatctgaaacactgtgga  12160700
        <---------ARR14(2)                                               --------->YAB1
        --------->ARR11(2)                                               --------->YAB5
        --------->GATA12                                     --------->bZIP60(1)               -----
        <---------ARR11(2)                                   <---------bZIP60(1)               <----
---ETT(2)<------ZmHOX2a(2)   --------->ZAT18            --------->At4g35610   --------->ZAT6   -----
===========RAV   <---------ARR14(2)                  <---------At4g35610<---------YAB5       <------NtERF2
-->ETT(2)==============HOX2a_HOX2a                   --------->At4g35610<---------YAB1       -------
---ZAT18--------->ARR11(3)  --------->ANAC58        <---------GATA12<----------DOF2        <--------
-----RVE1(2)    <------ZmHOX2a(1)                   ------->TEIL   <---------DOF5.7(1)<---------ALFIN1
-----------RAV1(1)          --------->ANAC58      <-------TEIL     <---------ICU4  --------->ANAC46<
cattgttggacgatctgcaggattttcttgaacgcacaataagcttatatggatgcatctgatgacttcatctttatcataactctcccccatggccggg  12160800
<- Previous    Next ->

AGI:  At4g23230.1   
Description:  protein kinase family protein. Identical to Cysteine-rich receptor-like protein kinase 15 precursor (CRK15) [Arabidopsis Thaliana] (GB:Q8W4G6;GB:O65475); similar to protein kinase family protein [Arabidopsis thaliana] (TAIR:AT4G23160.1); similar to protein kinase family protein [Arabidopsis thaliana] (TAIR:AT4G23150.1); similar to CRK10 (CYSTEINE-RICH RLK10), kinase [Arabidopsis thaliana] (TAIR:AT4G23180.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO63725.1); contains InterPro domain Protein of unknown function DUF26 (InterPro:IPR002902); contains InterPro domain Serine/threonine protein kinase; (InterPro:IPR002290); contain
Range:  from: 12157579    to: 12160280    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At4g23240.1   
Description:  protein kinase family protein. Identical to Putative cysteine-rich receptor-like protein kinase 16 precursor (CRK16) [Arabidopsis Thaliana] (GB:O65476); similar to protein kinase family protein [Arabidopsis thaliana] (TAIR:AT4G23290.1); similar to protein kinase family protein [Arabidopsis thaliana] (TAIR:AT4G23290.2); similar to unnamed protein product [Vitis vinifera] (GB:CAO63725.1); contains InterPro domain Serine/threonine protein kinase; (InterPro:IPR002290); contains InterPro domain Protein kinase, core; (InterPro:IPR000719); contains InterPro domain Protein kinase-like (InterPro:IPR011009); contains InterPro domain Serine/threonine p
Range:  from: 12160512    to: 12161964    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version