AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                             -------
                                                                                          <---------ARR11(3)
                                                                                          <---------ARR14(2)
                                                                                          --------->RVE1(2)
      <---------SPL7(1)                                                                   <---------ARR11(2)
     <---------ANAC58                                                                     --------->ARR14(2)
     <---------ANAC46                                                         <---------ZAT6 -------
--------AtLEC2                                                      --------->KAN1        --------->ARR11(2)
-ANAC58              <---------DAG2                              --------->At4g35610     <---------CCA1(2)
-ANAC58  --------->ANAC58                                        <---------At4g35610<-----------GT1
>YAB1<---------ANAC58<----------DOF2                    --------->WRKY38(1)  <---------TOE1(3)------
-ANAC46  --------->ANAC58    <---------ALFIN1       <---------RVE1(2)--------->KAN4(2)   --------->KAN1
 
tgcatggtccgtatgcaatttctacttttgcccctcgcccatctatggtcttatagctattgaccatgagctcattcgctagggttatgaccatatcctt  11705700
                                                 --------->TOE1(2)
                                                 --------->TOE2(2)
                                     --------->SPL7(1)
                                    <---------ARR14(2)
                                    <---------ARR11(2)
                                    --------->ARR14(2)
                                    --------->ARR11(2)
                               --------->ANAC46 ----------->RAV1(2)
                               --------->ANAC58------->TEIL
                               --------->ANAC58--------->GLK1(2)
                            <------ZmHOX2a(2) --------->ARR11(3)
                      <---------ANAC58      <---------MYB52(2)    --------->ZAT18               <---
                      <---------ANAC58    ---------->DOF2      <---------ANAC46          -----------
---------->DOF2       <---------ANAC46  --------->LBD16 <------NtERF2                   --------->bZIP60(1)
-->TOE1(3)       <---------ANAC58  <---------SPL1(2)   <---------MYB46(3)               <---------bZIP60(1)
-->TOE2(3)       <---------ANAC46  <---------SPL7(1)  --------->ALFIN1       --------->DOF5.7(1)----
>ZmHOX2a(1)      <---------ANAC58 --------->DEAR3(1)<---------ANAC46      <---------SPL7(1)    -----
 
agcgaaagtaatccacaatggcttggcttggatcacgccgtaccgcaaagaacctgggtgggggttttgtgcattgtcgtaagggtttgtgacaacatat  11705800
                                                                                                  <-
                                                                                             ------>NtERF2
                                                                                           <------NtERF2
                                                                                          ------>NtERF2
                                                                                          <---------ATERF1(1)
                                          --------->ANAC58                                <---------RAP2.6(3)
                                         --------->ZAT18                                 --------->RAP2.6(2)
                                         --------->LBD16                                 >>>>>>>>>AtERF-5
                                         >>>>>>>>>>AtSR1                                 >>>>>>>>>AtERF-1
                                         <---------LBD16                                 >>>>>>>>>AtERF-2
                                        ------->GAMYB                                    >>>>>>>>>AtERF-7
                                       --------->MYB46(3)                                >>>>>>>>>AtERF-3
                                      -------->P                                         --------->RAP2.3(2)
                                      ------>MYB83                                       <---------ATERF1(2)
                                      ------>MYB46(1)                                    --------->DEAR3(1)
                                     ------>MYB46(1)                                     --------->ATERF1(2)
                                     --------->MYB52(1)                                  --------->RAP2.3(3)
               <---------MYB55(2)    ------>MYB83                                        --------->RRTF1(2)
       <---------ANAC58           --------->ANAC58     <---------ARR11(3)                >>>>>>>>>AtERF-4
       <---------ANAC58<---------At4g35610--------->ANAC46                               --------->RRTF1(3)
    <----------DOF2    --------->At4g35610--------->ANAC58     --------->ATHB12         --------->ERF1
   <---------DAG2    <--------P ------>MYB83  --------->ARR14(2) <---------WOX13(1)     --------->RAP2.3(1)
   <---------DOF5.7(1)<-------TEIL--------->ANAC58     --------->ARR11(3)               --------->DEAR3(2)
<-----------GT1--------->MYB46(3) --------->ANAC46    <------MYB46(1)                   --------->RRTF1(1)
------AHL20(1)--------->ANAC58  ------>MYB46(1)       <------MYB83                      --------->ATERF1(1)
>RAV1(1)      --------->ANAC46<---------MYB59 --------->GATA12<---------YAB1           <---------At4g35610
----->AHL20(1)--------->ANAC58--------->AtMYB61    <---------MYB52(1)--------->KAN1    --------->At4g35610
---->AHL12(3)------>NtERF2  ------->TEIL--------->DEAR3(1) <---------REM1(2)<-----------HVH21-------
 
atattacctttcttgccacccaaggtagatgaaccaaacccaaccgcgcaatctgctaggtcttcacgattgacatcccagtcagacttgagccgccaac  11705900
                                                     --------->ATERF1(1)
                                                     <------NtERF2
                                                     <---------DEAR3(1)
                                                 --------->ZAT2
                                                 --------->At4g35610
                                                 <---------At4g35610
                                               --------->ATERF1(1)
                                              <---------ZAT14
                                              --------->ZAT14
                                              --------->At4g35610
                                           <---------ANAC46
                                           <---------ANAC58
                                           <---------ANAC58
                                        <--------P  ------>NtERF2 --------->LBD16
           <-------TEIL                <---------SPL7(1)         --------->ANAC46
         <---------ARR14(2)           <---------ANAC46 <------NtERF2
         <---------ARR11(2)          <------NtERF2  <---------LBD16
         --------->ARR14(2)         ------>NtERF2------>NtERF2   --------->ANAC58  --------->ANAC46
         --------->GATA12           --------->LBD16 --------->LBD16      <------------MYB.PH3(1)
         --------->ARR11(2)        <---------DEAR3(1)--------->ALFIN1   <---------At5g28300
       --------->LBD16             <---------ANAC46--------->DEAR3(1)  --------->MYB52(1)
     <---------LBD16              <---------LBD16<---------ZAT2  --------->ANAC55(2)
    --------->MYB52(1)          <---------DEAR3(1)--------->ATERF1(1)  ------------>MYB.PH3(1)
  <---------ZAT14           <-------TEIL--------->ALFIN1         --------->ANAC58  <---------RAP2.6(2)
  <---------ABI4(2)        <---------ARR14(2) <-------TEIL      <---------LBD16   <---------LBD16
  --------->ZAT14          --------->ARR14(2) <---------At4g35610--------->ANAC55(1) <------NtERF2
  --------->ZAT18       <---------TOE2(3) <------MYB46(1)  <----------TaMYB80  --------->KAN1
-----ZmHOX2a(1)         <---------TOE1(2) <------MYB83--------->LBD16  <-----------GT1<---------ANAC46
---->RAV1(1)--------->YAB1 <-----------ARR10 --------->ALFIN1--------->KAN1 <---------MYB52(1)   <--
 
aggagtccaccggattcatgatgttctgaggttcttcggcggggtagggtgcagccgcggggctatacccgtaataaccgttatatgcggcatggaccaa  11706000
                                                                                                   -
                                                                                                   -
                                                                                                   <
                                                                                                   -
                                                                                          --------->DOF5.7(1)
                                    --------->At5g28300                        <---------ARR14(2)  <
                             --------->ANAC58                                  <---------RVE1(2)   <
                             --------->ANAC46                                  <---------ARR11(2)  <
                             --------->ANAC58    <---------YAB5  <---------TOE1(3)        ----------
                          <------NtERF2       <---------YAB5     <---------TOE2(3)      ---------->DOF2
         --------->YAB1<------ZmHOX2a(1)   --------->YAB5    <----------DOF2   --------->ARR11(2)  -
----------->HVH21  <---------O2    ----------->GT1      <---------MYB52(1)     --------->ARR14(2)---
----ZmHOX2a(1)     --------->O2 --------->MYB52(1)    ----------->HVH21      ----------->GT1   -----
 
ggactgacataagaatagtgccacgaggaggcacgaaacggtgaaatgagtcatggtccgatgggtttaaggtttgagtagggatactaagaaaagagaa  11706100
      --------->ANAC58
 ------>ZmHOX2a(2)                         <---------SPL7(1)
<------ZmHOX2a(2)                          ----------->HVH21
-------->ARR14(2)                         --------->ETT(1)                        <---------O2
-------->ARR11(2)                         <---------ANAC46                        --------->TGA1a
---------ARR11(2)                --------->ARR11(3)                               <---------TGA1a
-------->ARR11(3)                <---------ARR11(3)                               --------->O2
---------ARR11(3)              ----------->ARR10                                  <---------ANAC58<-
---------ARR14(2)          <---------At4g35610                                    <---------ANAC58<-
---------GATA12            --------->At4g35610                          <------------CBF  <---------
->GT1 --------->ANAC58--------->ALFIN1  <-----------HVH21    ----------->GT1      <---------ANAC55(2)
-------->GATA12       <---------ZAT6   <-----------RAV1(1)  <---------AtMYB61     <---------ANAC46<-
------>DOF5.7(1)--------->DOF5.7(1)<------------CBF         --------->ALFIN1      --------->ANAC55(2)
----->DOF2     --------->MYB52(1)<---------RVE1(2)        --------->ALFIN1        ==================
 
aagatcggcaagtatacttaagggagtgttagatgagatattgtgtcggacagattagaaggtgtggtaaacttgtattggtgagacgtgagactttggt  11706200
                                --------->PCF5
                                <---------TCP16(1)
                                <---------TCP20
                                <---------TCP15(1)
                                <---------PCF5
                                <---------PCF2                                              ------->GAMYB
                                --------->PCF2                                           <----------
                               --------->ATERF1(1)                                   <---------GATA12
                               <---------ATERF1(1)                                   --------->RVE1(2)
                               <------NtERF2                                         --------->GATA12
                               ------>NtERF2                                       <---------AHL20(2)
                              ------>NtERF2                                        <---------AHL25(3)
                              <---------ATERF1(1)                 --------->ATHB12<---------AHL25(1)
               ----------->TBP--------->ABI4(2)                   --------->YAB5  --------->AHL25(3)
               --------->AHL20(2)                                <---------ATHB12 --------->AHL25(1)
          <------ZmHOX2a(2)  <---------ANAC58                    <---------YAB5   <---------AHL20(2)
         --------->RVE1(2)<---------DEAR3(1)                   --------->WOX13(1) --------->AHL20(2)
--------REM1(1)--------->AHL12(3)                       <---------YAB1          --------->WOX13(2)
--------MYB46(3)        --------->MYB52(1)           --------->ICU4 --------->ICU4--------->AHL20(3)
-DOF2    --------->ARR11(3)  <---------ANAC58       <---------AHL25(2)          <---------WOX13(2)
----------RAV1(1)    --------->ANAC46 --------->YAB5<---------AHL20(3)         --------->WOX13(1)
=bZIP_DOF<---------ARR11(3)------->GAMYB            --------->AHL20(3)       ------------>CBF   <---
 
gttgttgcacaagatcatatatatactcaacggcgggcccatgtttagcccctaaaattatgaaatcagtcattagttatagcaattaaatctaaccctc  11706300
                                                      <---------AHL12(1)
                                                      --------->AHL12(1)
                                                      <---------AHL12(3)
                                                      --------->AHL25(1)
                                                      <---------AHL20(2)
                                                      --------->AHL20(2)
                                                      --------->AHL12(3)
                                                      <---------AHL25(1)
                                                      <---------AHL25(3)
                                                     <---------AHL20(3)
                                                     --------->AHL25(1)
                                                     --------->AHL12(3)
                                                     --------->AHL20(3)
                                                     <---------AHL25(1)
                                                     <---------AHL25(3)
                                                     <---------AHL25(2)
                                                     --------->AHL12(1)
                                                     <---------AHL12(1)
                                                     <---------AHL20(2)
                                                     --------->AHL25(3)
                                                     --------->AHL25(2)
                                                     --------->AHL20(1)
                                                     --------->AHL20(2)
                                                    --------->AHL12(2)
                                                   --------->WOX13(2)
                                                   <---------WOX13(2)
                                                   --------->AHL12(2)
                                                 --------->AHL20(2)
                                                 <---------AHL25(1)
                                                 <---------AHL20(2)
                                                 --------->AHL12(3)
                                                 --------->AHL25(1)
                                                 --------->AHL12(1)               <---------AHL20(2)
                                                 <---------AHL12(3)             --------->AHL12(2)
                                                 <---------AHL12(1)            --------->AHL12(2)
                                                 --------->AHL25(3)            <---------AHL12(2)
                                                 <---------AHL25(3)           <---------AHL12(1)
                                                --------->AHL25(3)            --------->AHL20(2)
                                                --------->AHL20(2)            --------->AHL12(1)
                                               <---------AHL12(2)             <---------AHL25(1)
                                               --------->AHL12(2)             <---------AHL25(3)
                                             --------->ATHB51                 --------->AHL25(1)
             <---------DOF5.7(1)             --------->AHL20(2)               <---------AHL12(3)
            <---------DOF5.7(1)             <---------YAB1                    <---------AHL20(2)
            <---------DAG2                  --------->ICU4                    --------->AHL12(3)
            <----------DOF2               --------->YAB5                     <---------AHL20(2)
<---------AHL20(2)      --------->YAB1    --------->YAB1                     --------->AHL25(3)  ---
-GT1    <-----------GT1<---------YAB1    <-------TEIL<---------AHL20(1)     --------->AHL12(2)   ---
---------------------ANAC81       <----------DOF2<---------AHL25(2)     --------->TOE2(3)        <--
 
tatttcatttgtttcctttttcttctatgatcagtttctttgcattcattatttaatttattttgtttctagttatcttatttattttttagttttccaa  11706400
                                                              <---------AHL25(3)
                                                              --------->AHL25(3)
                                                    <-----------GT1
                                                 <---------AHL12(2)
                                                --------->AHL25(2)
                                                --------->AHL20(3)           <----------DOF2
                                                <---------AHL20(3)          <---------DOF5.7(1)
                                                <---------AHL25(2)       <---------ANAC58
                                                <---------AHL12(1)       <---------ANAC46
                                                --------->AHL12(1)       <---------ANAC58
                                             <---------AHL20(2)         ---------->ID1
                                             <---------AHL20(3)     --------->ANAC55(2)
                                             --------->AHL20(3)     <---------ANAC55(2)
                                             --------->AHL25(1)   <---------ICU4
                                             --------->AHL20(2)  --------->ICU4
                                             --------->AHL12(3) --------->WOX13(2)
                                             <---------AHL25(3) <---------AHL12(2)
                                             <---------AHL25(1) <---------WOX13(2)
                                             <---------AHL25(2)<---------AHL25(3)
                                            --------->YAB1    <---------AHL25(2)
                                           <---------YAB1     --------->AHL25(2)
                                          <---------WOX13(2)  <---------AHL20(2)
                                          --------->WOX13(2)  --------->AHL20(2)
                                        <---------AHL12(3)    --------->AHL12(3)
                                        <---------AHL20(2)    <---------AHL12(3)
                                        --------->AHL20(2)    <---------AHL25(1)
                                        --------->AHL20(3)    --------->AHL25(1)
                                        --------->AHL20(1)    --------->AHL20(1)
                                        <---------AHL25(3)    --------->AHL12(1)
                                        <---------AHL25(2)    <---------AHL12(1)
                                        --------->AHL25(3)   --------->AHL25(3)
           <---------DOF5.7(1)          <---------AHL20(3)   --------->AHL12(3)
          <---------DOF5.7(1)           --------->AHL25(2)   --------->AHL20(2)
          <----------DOF2               --------->AHL25(1)   --------->AHL25(2)
          ------>ZmHOX2a(1)            --------->AHL20(2)    <---------AHL25(2)
          <---------DAG2               --------->AHL12(3)    <---------AHL25(1)
      --------->ARR11(3)               --------->AHL25(2)    --------->AHL25(1)                 ----
      <---------ARR11(3)               --------->AHL25(1)    <---------AHL12(3)               <-----
------>AHL25(2)                        --------->AHL25(3)   --------->AHL12(2)           --------->ANAC58
------>AHL12(1)        <---------RVE1(2)<---------AHL25(1)  <---------AHL12(2)           --------->ANAC58
-------AHL12(1)      <---------YAB1    <---------AHL25(2)   <---------WOX13(2)  <---------CCA1(2) <-
 
atttttaaaaatcctttttgtattttgattttaaaaatacaattttattaaaattttacagaaaattaattatgtgtcgtcttttatctcactagcaaat  11706500
                    --------->At4g35610
                <-----------HVH21
                <---------SPL7(1)
               <---------ANAC58
           <---------ANAC58
           <---------ANAC58
      --------->ATHB51
      --------->ATHB12
     <---------AHL20(2)
     <---------AHL12(3)
     <---------AHL25(1)
     --------->AHL25(2)
     <---------AHL25(2)
     <---------YAB1 ----------->RAV1(2)
    --------->AHL25(2)
    <---------AHL25(2)                                                                        <-----
    <---------AHL20(3)        <---------AtLEC2                                                ------
    --------->AHL20(2)    --------->At4g35610                                                 <-----
    --------->AHL20(3)   <---------GATA12                     <---------RAP2.6(3)             <-----
    --------->AHL12(2)   --------->GATA12                     ------>NtERF2----------->GT1    ------
    --------->YAB1--------->SPL7(1)              <---------KAN1     <---------ANAC58          <-----
    <---------AHL20(1)   ------->TEIL        --------->ANAC58--------->DEAR3(1)         --------->GLK1(2)
----->AHL20(2) <---------ANAC58    <-------TEIL  --------->HSFB2a(1)<---------ANAC58  --------->KAN1
----WOX13(2)  --------->SPL7(1)    ------->TEIL ------->TEIL--------->DEAR3(2) --------->DOF5.7(1)
----------GT1 <-------TEIL<---------At4g35610--------->ANAC58--------->RAP2.6(2) --------->RVE1(2)<-
 
ttaacaatattattgggtccgtcccctgcatctgcatgtacatttctcacgaacatttctcaagccgacttgcttcgatggaaaaatccaaattctagat  11706600
<- Previous    Next ->

AGI:  At4g22090.1   
Description:  pectate lyase family protein. Identical to Putative pectate lyase 17 precursor [Arabidopsis Thaliana] (GB:O65457); similar to pectate lyase family protein [Arabidopsis thaliana] (TAIR:AT4G22080.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN60346.1); contains InterPro domain Pectin lyase fold (InterPro:IPR012334); contains InterPro domain Pectate lyase/Amb allergen (InterPro:IPR002022); contains InterPro domain Pectin lyase fold/virulence factor (InterPro:IPR011050)
Range:  from: 11704015    to: 11706054    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version