AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                        <-----------GT1
                                                                                     --------->WOX13(2)
                                                                                   --------->AHL12(1)
                                                                                   <---------AHL25(1)
                                                                                   --------->AHL12(3)
                                                                                   <---------AHL20(2)
                                                                                   <---------AHL12(1)
                                                                                   --------->AHL20(2)
                                                                                   <---------AHL25(3)
                                                                                   <---------AHL12(3)
                                                                                   --------->AHL25(1)
                                                                                  <---------AHL20(2)
                                                                                  --------->AHL25(3)
                                                                                 --------->AHL12(2)
                                                                              --------->ICU4
                                                                            <--------HAHB4
                                                                            --------->YAB1
                                                                            --------->YAB5
                                                                            <---------ICU4
                                    ---------->DOF2                        <---------ATHB12
                               ------>ZmHOX2a(1)                           --------->ICU4
                              --------->TOE1(3)                  --------->YAB1  <---------AHL12(2)
                              --------->TOE2(3)       <---------STY1(2)    <---------YAB1
                            ------>MYB46(1)           --------->STY1(2)    <---------YAB5
                            ------>MYB83              <---------ZAT2   <---------MYB52(1)
  <---------YAB5       <-----------GT1         --------->KAN1  --------->ANAC58--------->ATHB51
--------RVE1(2)    --------->AHL25(2)          --------->CCA1(2)<---------YAB5<---------YAB1   -----
-->WOX13(2)        --------->AHL20(3)      <------NtERF2       --------->ANAC58--------->AHL20(2) <-
---WOX13(2)        <---------AHL20(3) --------->DOF5.7(1) <---------YAB1 --------->WOX13(1)---------
 
agataaacatccacaagaacaaaattataccatccttaagaaaggccgagagatgctagctacgataagcatcagttaatcattatttattttacctcag  10660700
                                 <----------DOF2
                                <---------DOF5.7(1)
                   <---------At4g35610
                   ------>ZmHOX2a(1)        --------->HSFB2a(2)                                  ---
     <---------GLK1(1)      <------ZmHOX2a(2)               --------->LBD16--------->ANAC46     <---
     --------->bZIP60(1)   --------->ARR11(3)             ----------->RAV1(2)                   ----
     --------->GLK1(1)     <---------ARR11(3)    <----------ID1            <---------bZIP60(1) <----
     <---------bZIP60(1)   --------->RVE1(2)<---------HSFB2a(2)            --------->bZIP60(1)<-----
---->At4g35610     --------->At4g35610     <---------ETT(2) ------>ZmHOX2a(1)                 ------
--------KAN1       ================HOX2a_HOX2a   ----------->GT1       --------->RVE1(2)     <------
>TOE2(3)         --------->ZAT18<---------DAG2  ----------->GT1   --------->RVE1(2)    --------->ANAC55(2)
 
catcactgatatcagataagtcctctgcaagatcacctttagactgtcgagaaggaaaaactcctgaaaaatcaaatcacatcaccatttaagtatttac  10660800
                          <----------DOF2
           --------->ARR11(3)
          <---------GLK1(1)
         <---------ARR11(3)
     ---------->DOF2     <---------ICU4
    --------->AHL20(2)   --------->YAB5                               --------->MYB52(2)
------>LBD16            <---------YAB5                                <-----------RAV1(1)
------HSFB2a(2)        <---------ARR11(3)                             <---------MYB46(3)
----->HSFB2a(2)        --------->GLK1(2)                            <----------DOF2<----------DOF2
-----LBD16--------->GLK1(1)                                  <---------AtLEC2  --------->ARR14(2)
----At5g28300  --------->At4g35610     --------->ZAT6    <----------DOF2---------->ID1 <---------TOE2(3)
--->MYB52(1)   <---------At4g35610 --------->AHL20(2)   <---------DOF5.7(1)    <---------ARR14(2)
-----GT1 --------->ARR11(3)  <-----------GT1      --------->ALFIN1 --------->TOE2(3)   <---------TOE1(3)
 
cggaaaataaaagatatcatctgcataatctttaacaatataacactcatggagaggggtctttgcattacctttgttgccatatacttttaggtttcta  10660900
                                           <------ZmHOX2a(2)
                                          --------->RVE1(2)
                <-----------GT1          ------->GAMYB
             <---------GLK1(1)           --------->YAB5                       --------->DOF5.7(1)
             --------->GLK1(1)         ------>MYB83                          --------->DOF5.7(1)
          <---------YAB5               ------>MYB46(1)                      ---------->DOF2
      <---------ZAT14                 --------->MYB52(1)        <---------ANAC58
     <----------DOF2           <---------RVE1(2)                <---------ANAC58
  <---------ARR11(3) ----------->RAV1(2)--------->MYB46(3)      <---------GLK1(2)     <---------WOX13(1)
 <---------ATHB12  <---------ALFIN1  --------->AtMYB61--------->YAB1        --------->DOF5.7(1)
 
gccaataactttactgatttctccacctgaaattgatacaccaacgatcaaaaacattcaaaacatagcttctcaacaaaaaagagcagattgataccat  10661000
                                                                                <---------WOX13(2)
                                                                    --------------->AGL15
                                                                    ----------->RAV1(1)
                                                                    <---------------AGL15
                                                                   <-----------------AGL2
                                                                   ----------------->AGL3
                        <---------KAN1                             <-----------------AG
              --------->ANAC58                                     ----------------->AGL1
              --------->ANAC55(2)                             --------->DOF5.7(1)
              --------->ANAC58                              ---------->DOF2     --------->WOX13(2)
         ------>ZmHOX2a(1)                       --------->RVE1(2) <-----------------AGL1
     --------->ARR14(2)--------->GATA12          <---------ARR11(3)----------------->AGL2     <-----
 ---------->DOF2 --------->MYB52(1) <---------YAB5      <----------ID1     ----------->GT1<---------YAB1
 
caaacaaagttcctcataagtaatggaatctatagttttgtcatcgagccaatatcaataccacaaagagaccacatatggtaaactaagtttcttatta  10661100
                                        <------ZmHOX2a(2)
                                        =======================HOX2a_HOX2a
                                       --------->GATA12
                                       --------->RVE1(2)
                                       <---------GATA12                 <---------YAB1
                         <---------AHL20(2)                           <-----------GT1          <----
                         <---------AHL25(1)                        <---------AHL12(2)         ------
                         <---------AHL25(3)                       <---------AHL20(3)         <------
                         --------->AHL25(1)                       <---------AHL12(1)         <------
                        --------->AHL25(2)                        --------->AHL20(3)   ------------>CBF
                        <---------AHL25(2)              <------ZmHOX2a(1)             --------------
                        <---------AHL25(3)             --------->DOF5.7(1)        --------->ANAC58
                        --------->AHL25(3)            --------->DOF5.7(1)         --------->ANAC58
                        --------->AHL25(1)          <---------KAN1--------->AHL12(1)  <-------------
                        <---------AHL25(1)       --------->LBD16  <---------AHL12(2)  --------->ANAC58
     --------->YAB5     --------->AHL20(2)   --------->GLK1(2)    --------->AHL12(2)  --------->ANAC58
     <---------ICU4     <---------AHL20(2)   --------->GATA12     <---------AHL25(2)  --------------
     --------->YAB1     --------->AHL20(3)   <---------ARR14(2)   --------->AHL25(2)  <-------------
    --------->ICU4      <---------AHL20(3)   --------->ARR14(2)  <---------AHL12(1)   --------------
    <---------YAB1     <---------AHL12(2)    <---------GATA12----------->GT1      --------->ANAC46
  --------->YAB1       --------->AHL12(2)    --------->RVE1(2)   --------->AHL12(1)  ------->TEIL---
------GT1  ---------->DOF2            --------->At4g35610  ----------->GT1<------------CBF  --------
 
cattaccatgatcacaaagctctaaaatttaatctagaatcagatcaaaatccgaataaggagggagaaaattttaccattgttcacgaacccaatgcgg  10661200
                                                                                    ------>ZmHOX2a(1)
                                          --------->RVE1(2)                   ------->MYC4
                   <---------KAN1        --------->RVE1(1)                    <-------MYC4
                  <---------ARR11(2)    --------->AHL25(2)                    ------->MYC2
                  <---------GATA12      --------->AHL12(1)                    ------->MYC3
     --------->GATA12                   <---------AHL12(1)                    -------->ABF1
     <---------GATA12                  --------->AHL12(2)                     <-------MYC3
--NtERF2          <-----------ARR10    <---------AHL12(2)                    <---------ANAC55(2)
--->LBD16         --------->GATA12     --------->AHL12(3)                    =======================
---RAP2.6(2)      --------->ARR11(2)   <---------AHL12(3)                    <---------O2
----ID1           --------->ARR14(2) <---------AHL20(2)                      --------->TGA1a
--->AGL2          --------->GLK1(2)  --------->AHL20(2)                      --------->ANAC55(2)
----AGL1          <---------ARR14(2) <---------AHL20(3)                      <---------TGA1a
--->AGL1  <---------DEAR3(1)         --------->AHL20(3)    ----------->RAV1(2)<-------MYC2
----AG   <---------LBD16          --------->AHL20(2)     --------->ANAC58    --------->O2
--->AG ------>ZmHOX2a(2)         --------->AHL20(2)      --------->ANAC58<-----------GT1
------->DOF2     <---------GLK1(2)<---------AHL25(3)   <<<<<<<ZML2    --------->WOX13(2)
->RAP2.6(3)<---------DEAR3(2)--------->AHL20(2)    --------->TOE1(2)  <---------WOX13(2)          --
 
caaagatagatcgccggtgagaatctgggttttaaaataaaaaaatatcagaaacctagaacgcctgggtttgaattaacacgtgtcctagtcaaattgg  10661300
                                                     <---------ZAT18
                                            <---------AHL25(1)
                                            --------->AHL25(1)
               --------->ANAC58             <---------AHL12(3)
               --------->ANAC58           <-----------TBP
           ==========================bZIP_DOF        ------->TEIL
           --------->ANAC55(2)            <---------AHL12(3)
           --------->bZIP60(2)            <---------AHL20(3)
           --------->O2                 <---------RVE1(1)                             --------->LBD16
           --------->TGA1a              <---------CCA1(1)              --------->GLK1(2)
           <---------TGA1a<----------DOF2 --------->AHL20(3)           --------->GATA12
           <---------O2  <---------DOF5.7(1)--------->AHL20(2)         --------->ARR14(2)
           --------->ANAC58            <---------RVE1(2)               <---------ARR11(3)
           --------->ANAC58            <---------AHL20(1)              <---------ARR14(3)
           --------->ANAC46      --------->YAB1     <-----------GT1    --------->RVE1(2)
           <---------ANAC55(2) <---------RVE1(2) --------------->AtSPL8--------->ARR14(3)   --------
           --------->ANAC55(1)--------->YAB1<---------AHL20(2)         --------->ARR11(3) ----------
    =================bZIP_DOF<---------YAB1 --------->AHL12(3)     --------->YAB1    ---------------
    <----------DOF2 --------->DEAR3(1) <---------ARR11(3)  <----------DOF2      <---------KAN1
===============bZIP_DOF  <---------DAG2--------->ARR11(3) <---------DOF5.7(1) <---------RVE1(2) <---
--------------------->TaNAC69(2)<---------YAB1<---------YAB1     --------->RVE1(2)   <--------------
 
ttataggctttgccacgtaagcacagacccttttgataataagatatttatatttgtaccctctttaatatcaaaatcttcgattttcccccaaaaagaa  10661400
                            <---------YAB5                                                  <-------
                      ----------->GT1                                                    <---------ARR11(2)
                   <---------MYB46(3)                                                   <---------CCA1(2)
   --------->LBD16<---------ZAT6                                                     <<<<<<<<<<AtSR1
  <---------HSFB2a(2) <---------MYB46(3)                                          --------->KAN1
  --------->HSFC1(1) <---------AtMYB61                     ------>NtERF2         --------->ARR14(2)
  <---------HSFC1(1) --------->ALFIN1                   <---------DEAR3(2)       <---------ARR14(2)
  --------->HSFB2a(2)<---------ANAC46                   <---------At4g35610      <---------ARR11(2)
--->GT1           <---------AtMYB61                     --------->At4g35610      --------->ARR11(2)
>DOF2             --------->ALFIN1                     <---------DEAR3(1)       --------->DOF5.7(2)
>AGL15        <---------ZAT14                        <-----------HVH21   ----------------------->TaNAC69(2)
------AHL12(1)--------->ZAT14                <----------DOF2  ---------->DOF2 <---------ANAC46
-AGL15        --------->ZAT18        *TSS   <---------DOF5.7(1) --------->DOF5.7(1) --------->ANAC55(2)
 
aatttccagaaaacgagcgtagtggtggtgaatcactgactcttctctctttcgctcgtcgctgcgaaagagcatttgttttcgtttacgcgtttctttt  10661500
                                                                               --------->At5g28300
                                                                              <------MYB83
                                                                              <------MYB46(1)
                                                                              <---------DEAR3(2)
                                                                --------->AHL12(2)
                                                                --------->AHL25(1)
                                                                <---------AHL25(2)
                                                                <---------AHL12(3)           -------
                                  <----------DOF2              --------->AHL12(1)            -------
                 <---------HSFB2a(2)            --------->ARR14(2)            ----------->GT1-------
                 >>>>>>>ZML2     <---------DOF5.7(1)      <---------TOE2(3)  --------->MYB46(2)
                 --------------->AGL15          <---------ARR14(2)           <---------DEAR3(1)
       <---------ZAT14           <---------ICU4 --------->RVE1(2)            --------->MYB55(2)
       --------->ZAT18         --------->GLK1(2)<---------ARR11(2)           <---------MYB46(3)
    <---------ANAC46       <-----------GT1      --------->ARR11(2)           <---------DEAR4(1)
    <---------ANAC58    ----------->GT1        <---------CCA1(2)<---------AHL20(2)  --------->AHL12(1)
    <---------ANAC58   --------->DAG2          --------->KAN1  <---------AHL12(1)  --------->AHL12(2)
---DOF2<---------ZAT18---------->DOF2   <---------At4g35610<---------YAB1   <---------ORA47(1)
 
tctcgttgagtgcatttgttctaggtaaagtaacaatcttttcttctgctatatccgaattgatgatttttttttttgggtcggtgaatttttgctacgc  10661600
<- Previous    Next ->

AGI:  At4g19550.1   
Description:  transcription activator/ transcription regulator/ zinc ion binding. similar to RNA polymerase II transcription factor [Arabidopsis thaliana] (TAIR:AT3G09360.1); similar to unknown [Populus trichocarpa] (GB:ABK92899.1); contains InterPro domain Brf1-like TBP-binding; (InterPro:IPR011665); contains InterPro domain Transcription factor TFIIB related; (InterPro:IPR000812)
Range:  from: 10659391    to: 10661109    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At4g19560.1   
Description:  CYCT1;2; cyclin-dependent protein kinase. Identical to Cyclin-T1-2 (CYCT1-2) [Arabidopsis Thaliana] (GB:Q56YF8;GB:O49474); similar to CYCT1,4, cyclin-dependent protein kinase [Arabidopsis thaliana] (TAIR:AT4G19600.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO47935.1); contains InterPro domain Cyclin (InterPro:IPR006670); contains InterPro domain Cyclin-related (InterPro:IPR013763); contains InterPro domain Transcription regulator cyclin (InterPro:IPR015429); contains InterPro domain Cyclin, N-terminal (InterPro:IPR006671); contains InterPro domain Cyclin-like (InterPro:IPR011028)
Range:  from: 10661438    to: 10664726    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version