AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
       <---------ANAC58
       <---------ANAC58                                    --------->YAB1
-------->RVE1(2)                                        <---------ICU4
---ARR14(2)                                             --------->YAB1
-->GLK1(2)                                             <---------YAB5
---ARR11(2)                                         <---------AHL20(2)
-->ARR14(2)                     <---------TOE2(3)   --------->KAN1                          --------
-->ARR11(2)                  <----------DOF2       --------->AHL20(2)                    --------->TOE2(3)
--GLK1(2)             --------->YAB1           <---------YAB5                         <-----------GT1
-RAV1(2)              ----------->GT1        <-----------GT1 <---------YAB1--------->ARR14(2)
 
tgtatcaatttcgtcttcgctaaaatcgtaaactttaggttttctgtttaaccatttattcatcacaattgatggccaaaacctctgttttacatcaaag  9994000
                                                                                             -------
                                                                                             -------
                                                                           ------->TEIL      -------
                                                              --------->YAB1                 <------
                                                              --------->TOE2(3)              -------
                                                            <---------ARR14(2)               -------
                                                            <---------ARR11(3)               <------
                                              --------->AHL20(2)         <---------ZAT18     =======
                       --------->YAB1        <---------KAN1 <-----------ARR10                -------
                      <---------YAB5       --------->YAB1   --------->RVE1(2)          --------->ARR11(2)
             <---------KAN1      <---------TOE2(3)          --------->ARR14(2)         <---------ARR11(2)
             <---------YAB5     ---------->DOF2             --------->GLK1(2)        --------->HSFC1(2)
            <-----------ARR10  --------->AHL25(1)          <---------GLK1(2)         <---------HSFC1(2)
            <---------ARR11(3) --------->AHL20(2)          <---------ARR14(1)     <------ZmHOX2a(1)
            --------->GLK1(2)  <---------AHL20(2)  --------->DOF5.7(1)  <---------ANAC58    <-------
-->DOF2    <---------GLK1(2) <---------WOX13(2)  ---------->DOF2        <---------ANAC58   <--------
 
acgagaaaacatcagaatctttgtaatcagagaattaaagaaacaagaataaaaaagagagagaatcttaatcttgtgtacctcaggacgtttcccacgt  9994100
                            <---------ARR11(3)
                            --------->ARR11(3)
                            <---------RVE1(2)
                            <---------GLK1(2)
-->ANAC46               ---------->DOF2                     <---------KAN1
-->bZIP60(2)     ------>ZmHOX2a(2)                  --------->HSFB2a(2)
-->TGA1a        <------ZmHOX2a(2)                   <---------LBD16                                -
---TGA1a        <---------GLK1(1)                   <---------HSFB2a(2)                            <
-->ANAC58      --------->GATA12                --------->HSFB2a(1)                              ----
-->O2          --------->ARR11(3)              <---------HSFB2a(1)                           -------
---O2          <---------GATA12                --------->HSFC1(2)                          <--------
===================================bZIP_DOF    <---------HSFC1(2)                          <--------
-->ANAC58      <---------ARR11(3)        <---------LBD16   --------->GLK1(2)               ---------
--TOE1(2)      <---------AGP1         <----------DOF2  <------ZmHOX2a(1)                <---------RVE1(2)
-ALFIN1       <---------CCA1(2)   ---------->ID1   <---------ANAC46          <-----------HVH21 <----
 
cttgttttcatcttcttagatctcagaaaaagattttgtttctttgggggagtttcgaggagaatttgaacagaagaaaatgtcagagtttgatatttat  9994200
                                                                                                ----
                                                                                              ------
                                                                                            --------
                                                                                            ========
                                                                                            <-------
                                                                                            ========
                                                                                            --------
                                                                                            ========
                                                                    --------->DOF5.7(1)     ========
                                                                    --------->DAG2          <-------
 ----------->HVH21                                                 =================================
-------->YAB1                                                      --------->DOF5.7(1)      <-------
---------ICU4                                              ----------->GT1  ----------->GT1 <-------
----->YAB1                                               ---------->DOF2   <---------------AtSPL8
-->YAB1                                                  ===========================================
-AHL20(3)            --------->CCA1(2)              <------ZmHOX2a(1)     <---------ANAC46  <-------
-AHL12(3)    ---------->DOF2                      --------->DOF5.7(1)  --------->ALFIN1     <-------
>AHL20(3)----------->GT1 --------->ANAC58         ------------------------>ANAC81           <-------
-----YAB1<---------ZAT6  --------->ANAC58       ---------->DOF2    ---------->DOF2--------->ANAC46
 
aatagtgacagagagttaaagaagagacacgaactagagcaagaacaagaagaaaggacacaaagaaaaaaaaagtggagagtacaaacaagaagacgtg  9994300
                                                                    <-------TEIL
                                                                 <---------ANAC58
                                                            <---------AHL20(2)
                                                          --------->AHL12(2)
                                                          <---------AHL12(2)
   ---------->DOF2                                        <---------YAB1
------->HVH21                          <---------YAB1    --------->AHL12(2)
--->ALFIN1                             ----------->GT1   --------->AHL12(3)
->TGA1a                              <---------ICU4      --------->AHL25(2)
===========================bZIP_DOF  --------->YAB1      <---------AHL20(2)
--TGA1a                              --------->YAB5      <---------AHL20(3)
==============bZIP_DOF               -------->HAHB4      <---------AHL20(1)
->O2                                --------->ICU4       <---------AHL25(2)
==============bZIP_DOF       ----------->GT1           --------->AHL25(1)
===========================bZIP_DOF <---------ATHB12   <---------AHL12(3)                       ----
--ANAC55(2)                 --------->DAG2             <---------AHL20(2)                       <---
==bZIP_DOF                  --------->DOF5.7(1)        <---------YAB1                           ----
--O2                       --------->DOF5.7(1)         --------->AHL12(2)                    <------
--ANAC55(1)               ---------->DOF2  --------->KAN1--------->AHL20(3)                 <-------GAMYB
==bZIP_DOF                --------->DOF5.7(1)          --------->AHL25(3)         --------->ANAC58 <
--ANAC58          ----------->GT1   <---------YAB5     <---------AHL25(2)       ---------->DOF2 <---
--ANAC58        ---------->DOF2     <---------YAB1  <---------RVE1(2)--------->MYB52(2)    <--------
--ANAC46 ---------->DOF2 --------->DOF5.7(1)--------->KAN4(2)    <---------ANAC58 --------->ANAC58<-
 
tgaaggcaaaggcaaaggcaaaagaaaaaaaaaggtgtaatgatgaaaattctctgatattattttttgggttcgtttcgaagaaaagctatggctgtta  9994400
                                                    <---------AHL20(2)
                                                <---------DOF5.7(1)
                                               <---------DOF5.7(1)
        --------->MYB52(2)                     <----------DOF2
  ------->GAMYB            ------>MYB46(1)  <---------ALFIN1
 --------->MYB46(3)        ------>MYB83   <------ZmHOX2a(2)
----->WOX13(2)           <---------MYB59 --------->ARR11(2)
------WOX13(2)    ---------->DOF2        --------->ARR14(2)
----->AHL12(2) --------->ANAC58          <---------ARR11(2)         --------->AHL12(1)
---MYB52(1)--------->WRKY12--------->MYB52(1)  <---------DAG2     <---------RVE1(2)
-----------GT1 --------->ANAC58          <---------GATA12   <---------ICU4
------AHL12(2) --------->ANAC46          --------->GATA12   --------->ATHB51                       -
-MYB46(3)  --------->WRKY38(1)         <---------ANAC58  --------->YAB1                ---------->DOF2
----------GT1<---------ANAC46  *TSS    <---------ANAC58 <---------YAB5   <---------LBD16<---------TOE2(3)
 
tttaacagccttcgttgcccgtaaagaaccaaactgcaacttgcgatccactttttttattcataatttgattttttggggaagacatattaaagaaaac  9994500
                                          <-------MYC2
                                          ------->MYC3
                                          ------->MYC4
                                          <-------MYC4
                --------->WOX13(2)        ------->MYC2                    <---------ZAT2
              --------->AHL20(3)         --------->ANAC55(2)             -------->P
              <---------AHL20(3)         ======================bZIP_DOF  ------>MYB46(1)
              --------->AHL25(1)         =========================================MYC_MYB
              --------->AHL20(2)         <---------TGA1a                 ------>MYB83
              <---------AHL25(3)         <---------ANAC55(2)           ----------->HVH21
              <---------AHL25(1)         --------->TGA1a               <---------MYB59
             --------->AHL20(2)          --------->O2                  --------->DEAR3(1)
             --------->AHL25(3)          <---------O2                 --------->MYB46(3)
           <---------GATA12     <----------DOF2               --------->KAN1
           --------->GATA12    <---------DOF5.7(1)  <----------DOF2   --------->DEAR3(2)
      <-----------HVH21  --------->GLK1(1)<-------MYC3       <---------ARR11(3)                 <---
 --------->DOF5.7(1)<---------LBD16    <---------ALFIN1      --------->ARR11(3)    <----------------
--------->DOF2<---------AHL20(2)===================bZIP_DOF<---------RVE1(2)       <-----------GT1
 
tataaagactgtcagatttaattccctgatttcttctttctcacacgtgttttcggtttttggatatattcgaaccgacctggttttctcaattcggttt  9994600
                            <---------AHL12(3)
                            --------->AHL20(3)
                            --------->AHL25(2)
                            <---------AHL20(3)
                            <---------AHL25(2)
                           --------->ATHB51
                           -------->ATHB1
                           --------->YAB5
                           <---------ICU4
                           <--------HAHB4
                          <---------AHL12(1)
                          --------->ICU4
                          --------->AHL25(3)
                          <---------KAN1
                 --------->AtMYB61
               ------>MYB83--------->YAB1
              --------->ORA47(1)
             <---------MYB46(2)
             <---------MYB59<---------AHL12(2)
             --------->MYB46(3)
             <---------MYB111(1)
             --------->DEAR3(1)                                                      <---------KAN1
          <-----------GT1 <---------YAB5<-----------GT1 <---------RVE1(2)<---------TOE1(3)
       <---------------AtSPL3<---------YAB1             --------->ARR11(3)          --------->RVE1(2)
       <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)             <---------YAB1     <---------TOE2(3)
<---------ZAT14------>MYB46(1)  <---------YAB1   <----------DOF2     --------->WOX13(2)
--------GT1 --------->DEAR3(2)--------->YAB1    <---------DOF5.7(1)  <---------WOX13(2)
-AGL1--------->ATHB12 <---------MYB59--------->YAB5   <---------TOE2(3) ---------->DOF2
 
tactagactgattgtaccgaccataccgaattattataaatgtttacttcatcttttaagatagtggcatttagttaaagtaaaccgaatcaaacagaca  9994700
                                   --------->AHL12(1)
                                   <---------AHL20(2)
                                   <---------AHL12(1)
                                   <---------AHL25(3)
                                 <---------WOX13(2)
                                 --------->WOX13(2)
                                 --------->AHL12(2)
                               --------->AHL25(3)             <---------ARR11(2)
                               <---------AHL20(2)             <---------ZAT14
                              --------->AHL25(3)              --------->ARR14(2)
                              <---------AHL25(1)              --------->ARR11(2)
                              --------->AHL25(2)              <---------ARR14(2)
                              --------->AHL25(1)           <---------ANAC46                    <----
                              <---------AHL12(3)           <---------ANAC58                  <------
                              --------->AHL20(2)--------->AHL25(2)                           <------
                              <---------AHL20(2)<---------AHL25(2)                           <------
              ---------->DOF2 --------->AHL12(3)<---------AHL20(2)            <---------WOX13(2)<xxx
            <---------YAB1    <---------AHL25(2)--------->AHL12(3)  <---------WOX13(2) --------->DOF5.7(1)
     <----------DOF2   ------->GAMYB            --------->AHL25(1) ----------->GT1 <----------------
     <---------DAG2 --------->MYB52(1)     <---------YAB5  <---------ANAC58   --------->WOX13(2)<---
 
gactgaaacttttttataaaagttaaccgaaattttaatttatctaaacattttttttttttgcgtatactagttaaactgaattagcaaaaaatggctc  9994800
                                                --------->AHL12(1)
                                             --------->YAB5
                                         --------->DAG2                            ----------->HVH21
                                    <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)            <---------MYB59
-----MYB46(3)                     --------->LBD16                                --------->At4g35610
---ANAC46                       <---------LBD16 <---------AHL12(1)               <---------At4g35610
---ANAC58                   --------->ARR14(2) --------->ICU4                  <---------WRKY18(1) <
---ANAC58                   <---------ARR14(2) <---------YAB1                 --------->WRKY38(1)  <
xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)<---------ANAC46                             --------->WRKY12   <--
-AGL3                  --------->ANAC58  --------->DOF5.7(1)      <---------At4g35610           <---
----GAMYB              --------->ANAC58 ---------->DOF2           --------->At4g35610         ------
 
gttggaagtcaaaactatattttgacaagcagttttgcggagtaaaagtgattatttgagaattagttttgctgaaatactttgacctgacttaagttag  9994900
<- Previous    Next ->

AGI:  At4g18010.1   
Description:  IP5PII (INOSITOL POLYPHOSPHATE 5-PHOSPHATASE II); inositol-polyphosphate 5-phosphatase. Identical to Type I inositol-1,4,5-trisphosphate 5-phosphatase 2 (IP5P2) [Arabidopsis Thaliana] (GB:Q9FUR2;GB:O49700;GB:Q9SNF1;GB:Q9ZSC3); similar to IP5PI (INOSITOL POLYPHOSPHATE 5-PHOSPHATASE I), inositol-polyphosphate 5-phosphatase [Arabidopsis thaliana] (TAIR:AT1G34120.2); similar to inositol-1,4,5-triphosphate-5-phosphatase [Solanum lycopersicum] (GB:ABV90875.1); contains InterPro domain Inositol polyphosphate related phosphatase; (InterPro:IPR000300); contains InterPro domain Endonuclease/exonuclease/phosphatase (InterPro:IPR005135)
Range:  from: 9991024    to: 9994432    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version