AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
-------->RAV1(1)                                                               ----------->HVH21
------>MYB52(1)                                                              ----------->RAV1(2)   <
--->MYB46(1)                                                               <---------ALFIN1   ------
-->GAMYB                                                             <---------RVE1(2)        ------
---->MYB46(3)       ----------->HVH21                            ------>ZmHOX2a(1)          <-------
->P   <----------DOF2             <----------DOF2  <---------GLK1(2) <---------GLK1(2)   <<<<<<<ZML2
>MYB46(3)  --------->GATA12      <---------DOF5.7(1)             <---------At4g35610 --------->TOE1(2)
caacagcttctttcaatctccctgtaacacatagaccctttaatgtcttatctagcttctctgttttcctctgattctccacctgaaacctagaaccaaa  9289200
                                                  --------->YAB1        <-------TEIL--------->ANAC55(2)
     --------->ANAC58                            <---------YAB5     --------->DOF5.7(1)
     --------->ANAC58        <-----------GT1     <---------YAB1     --------->DAG2  <---------ANAC55(2)
---------YAB1              <----------DOF2      <---------ARR11(3)--------->DOF5.7(1)    --------->CCA1(2)
>MYB46(1)       --------->DAG2                  --------->ARR11(3)---------->DOF2 <-----------GT1
>MYB83         ---------->DOF2                 --------->YAB5  <---------YAB1 <----------DOF2
--MYB59        --------->DOF5.7(1)          --------->CCA1(2)--------->YAB1  <---------DOF5.7(1)
ttttgatcactcaatggaaaaagcttcagactttacaatctcataagagatgatcatagcagaattataaaaaggttcagcctttatacgtgatacaaga  9289300
            <---------------AGL15                                                        <---------ANAC58
            --------------->AGL15                                                        <---------ANAC58
           ----------------->AGL3                                                        <---------ANAC46
         --------->GLK1(2)                                                             --------->LBD16
       --------->YAB5                                                                --------->SPL7(1)
       --------->KAN1                                                                <---------LBD16
      <---------YAB5                                         ------>MYB83         --------->KAN1
    ---------->DOF2                              ------->TEIL------>MYB46(1)    --------->ANAC58
  --------->ARR11(3)                --------->RVE1(2)     --------->HSFB2a(1)   --------->ANAC58
 --------->YAB1           <---------KAN1--------->LBD16   <---------HSFB2a(1)   --------->ANAC46 ---
acaaagataaagattccaattttagacgaataaacccaaaatcagggaaatgaatttcgaaaccttccaattctcttctctgcaagcatccggcgtagga  9289400
       <---------KAN1                 ----------->RAV1(2)
       --------->GLK1(1)            <---------TGA1a
      <----------DOF2               <---------O2
  <------NtERF2                     --------->TGA1a
<---------DEAR3(1)                  --------->O2
>>>>ARR1--------->ARR14(2)         <------NtERF2
>>>>ARR2<---------ARR14(2)        ------>NtERF2
---->ARR11(3)                     <---------ATERF1(1)
-----ARR14(2)                    --------->DEAR3(1)
---->ARR14(2)                   --------->DEAR3(2)                   <---------ZAT14
-----ARR11(2)                --------->SPL7(1)                       --------->ZAT14
---->ARR11(2)          <---------ARR11(2)                            --------->ZAT18
---->GATA12--------->HSFB2a(2) --------->At4g35610                  --------->ALFIN1
-ZmHOX2a(1)<---------ANAC46--------->LBD16    ------>NtERF2<---------GLK1(1)                   <----
--TOE1(2)  <---------HSFB2a(2) <---------At4g35610         --------->GLK1(1)  --------->ATHB12 -----
--TOE2(2) <---------LBD16<---------LBD16     --------->ANAC58    --------->LBD16     --------->ANAC58
--->ZmHOX2a(2)         --------->ARR11(2)    --------->ANAC58   --------->LBD16      --------->ANAC58
tcgtcgtcgcatttccggagaacatagaaccggaagccgacgtctgagacgcctctgtttggaactcccgagtgtagtaaaccattgcaagcttattcag  9289500
                                 --------->DOF5.7(1)   <---------YAB5 --------->DEAR3(1)
                       <---------GLK1(1)               <---------YAB1 <---------MYB111(2)
                      --------->GATA12           <---------TOE1(3)    --------->MYB46(3)
                      <---------RVE1(2)          <---------TOE2(3)    <---------MYB55(2)
        ----------->GT1<---------KAN1           --------->MYB52(1)   --------->ANAC58
-----At4g35610    <---------------ANT           <---------DOF5.7(2)  --------->ANAC58            <--
---->At4g35610 --------->ATHB12---------->DOF2  <-----------GT1 --------->TGA1a                 <---
cttgaagcaaatagtcaaacattgggatttgtgagaaagagaagaagagattaacgttttcattctcacatcacccaccttaccgatggagaaattgtgc  9289600
                     <---------TOE1(3)                                     <---------AHL20(3)
        <---------ICU4                                                   --------->AHL20(2)
        --------->AHL12(3)                                               <---------AHL20(2)
        --------->AHL12(1)                                               <---------AHL25(1)
      <---------AHL12(2)                                                 <---------AHL12(3)
      --------->AHL12(2)                                                 ----------->TBP
     <---------AHL25(3)                                                  --------->AHL25(1)
    --------->AHL20(2)            <---------ZAT14                        --------->AHL20(3)        -
    --------->AHL25(1)         --------->ANAC58                          --------->AHL12(3)      <--
   *TSS <---------AHL12(1)   ---------->DOF2                             <---------AHL20(3)     ----
-------LBD16         <---------TOE2(3)       ----------->GT1  <---------AHL20(1)               <----
------ANAC46     <---------KAN1--------->ANAC58   --------->AHL12(2)  <---------RVE1(2)     <-------
ctcggaattaaaaatttcgaatttagggttcttcaagcacagtggaaagtgtttaatatttgtaatatgttttgatataaatatgtctgatttcagttat  9289700
        xxxxxxxxxxxxxxxxx>smallRNA(se3)              xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
      xxxxxxxxxxxxxxxxxxx>smallRNA(i2)               xxxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
      *TSS                                           xxxxxxxxxxxxxxx>smallRNA(se3)
      xxxxxxxxxxxxxxxxxxx>smallRNA(fl3)             xxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
      xxxxxxxxxxxxxxxxxxx>smallRNA(se3)            ---------->DOF2  --------->RVE1(2)
      xxxxxxxxxxxxxxxxx>smallRNA(fl3)            xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
      xxxxxxxxxxxxxxxxx>smallRNA(si3)            xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
      --------->ICU4          <------NtERF2      xxxxxxxxxxxxxxxx>smallRNA(fl3)
      xxxxxxxxxxxxxxxxx>smallRNA(se3)           xxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
      xxxxxxxxxxxxxxxx>smallRNA(s)              xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
--------->DAG2               ------>NtERF2     xxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)                <
--------->DOF2     <------MYB83             xxxxxxxxxxxxxxxx>smallRNA(s)                          <-
-------AHL20(2)    <------MYB46(1)       xxxxxxxxxxxxxxx>smallRNA(si3)  <---------ALFIN1        ----
----->AHL20(2)    <---------AtMYB61  <-----------RAV1(2) <---------ANAC58               <----------DOF2
-----YAB1        <--------P  xxxxxxxxxxxxxxxxxxx>smallRNA(fl3)  <-------TEIL        <---------GLK1(2)
--MYB52(1)    <------NtERF2xxxxxxxxxxxxxxxxx>smallRNA(si3) --------->ALFIN1        --------->KAN1 --
taaaaagtcaagatggccgagttggtctaaggcgccagtttcaggtactggtccgaaagggcgtgggttcaaatcccactcttgacatattctttttgta  9289800
      <---------AHL12(3)                 --------->AHL12(3)
      --------->AHL20(2)                 --------->AHL12(2)
      <---------AHL25(1)                 <---------AHL12(2)
      --------->AHL12(1)                 <---------AHL12(3)
      <---------AHL12(1)                --------->AHL12(2)
      <---------AHL25(3)               <---------AHL12(1)
     --------->AHL20(2)                --------->AHL12(1)
     --------->AHL25(3)                --------->ICU4  <---------YAB1
-----------GT1                         <---------KAN1  ----------->GT1--------->DOF5.7(1)
--------AHL20(2)                    <------ZmHOX2a(1)  --------->AtLEC2           --------->YAB5
----->WOX13(2)                <---------YAB1    ---------->DOF2     ---------->DOF2   --------->DOF5.7(1)
------->AHL20(2)            --------->YAB1    --------->YAB1  ---------->DOF2    <---------YAB1 ----
tttaactatttatttttttcttatatgaaaaacataataggaatatttatcaaaagtcatgaaaataaagaaaaagaagagaagatgataagagagaaca  9289900
        <---------At4g35610                                                         <---------YAB1
        --------->At4g35610                                           --------->AHL20(2)
    --------->WOX13(2)                                               <---------YAB1<---------AHL25(2)
    <---------WOX13(2)                                               <---------YAB5<---------WOX13(2)
    <---------AHL12(2)                                              <---------AHL12(2)
   --------->YAB1                                                   --------->AHL12(2)
   --------->ATHB12                                                 <---------WOX13(2)
   <---------ICU4                                                   --------->WOX13(2)             <
   --------->YAB5                                                 --------->AHL20(2)--------->ICU4 <
   <--------HAHB4                                                 <---------AHL20(2)--------->AHL25(3)
   --------->ATHB51                                              <---------MYB52(1)<---------AHL12(2)
  --------->ICU4                                                --------->WOX13(2) <---------AHL12(3)
  --------->AHL20(2)                                           ----------->GT1     --------->AHL20(3)
  <---------KAN1   --------->TOE2(3)                       <---------WOX13(2)      <---------AHL20(3)
  --------->AHL12(1)             <----------DOF2       --------->ANAC55(2)         --------->AHL12(2)
  <---------AHL12(1)            <---------DOF5.7(1)    <---------ANAC55(2)        --------->YAB5   <
  --------->AHL25(3)   <---------At4g35610             --------->ANAC58         <---------ARR11(3)--
--------->YAB1     <----------DOF2<---------DOF5.7(1)  --------->ANAC58<---------AHL12(2)   <-------
------>DOF2  --------->ZAT6<---------RVE1(2)           ----------->GT1--------->YAB1<---------YAB5<-
aaagaataattagctaacacaactttagatgatactctttttttgtttgttttaagacaggtaattcagttaattataaactagataattatttctcgtg  9290000
<---------ANAC58   --------->GATA12        ---------->DOF2
---------MYB46(3)  <---------GATA12       <------ZmHOX2a(1)
------MYB83      <-------TEIL         <---------ANAC46
------MYB46(1)--------->ANAC58  --------->ARR11(3)                                                 <
------->MYB59 --------->ANAC58  <---------ARR11(3)                                                 <
--ANAC46      <---------ANAC55(2)--------->CCA1(2)               <----------DOF2                  <-
--------AtMYB61  ------->TEIL   <---------RVE1(2)     <---------ANAC46                <---------YAB1
tttggttggcttaaaacacgtacatctgtgtttgagatatgtcgaggaaagtgttcgtcgtgggaagacttttcttccaacttgaaattttgatacaaac  9290100
<- Previous    Next ->

AGI:  At4g16470.1   
Description:  binding. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT1G11290.1); similar to hypothetical protein OsJ_021177 [Oryza sativa (japonica cultivar-group)] (GB:EAZ37694.1); similar to Os06g0625800 [Oryza sativa (japonica cultivar-group)] (GB:NP_001058115.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 9287884    to: 9289604    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At4g16475.1   
Description:  pre-tRNA. tRNA-Leu (anticodon: CAG)
Range:  from: 9289707    to: 9289787    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version