AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
           --------->GLK1(2)
     <---------PCF2
  --------->ALFIN1
<---------ANAC46                                                                        <-------GAMYB
--------->O2                                                                           ----------->GT1
<---------bZIP60(2)                               <----------DOF2               <---------ANAC46
<---------TGA1a                                  <---------DOF5.7(1)            <---------ANAC58
--------->TGA1a         --------->KAN1    --------->ANAC46                      <---------ANAC58
<---------O2 <---------ICU4           --------->YAB1   <---------YAB5    --------->AHL20(2)
 
tcgacgtgggtcacaatctttgcagttttatcccaaaacaaaaataagacactctttaatcttcaagttaagacacttaaatgtcgtagactgttacatt  8222100
                                                                                                   -
                                                                                                   <
                                                                                               <----
                                              --------->YAB5                                   -----
                                             --------->ICU4                                  <------
                                    --------->ARR14(2)                                      --------
                                    <---------ARR14(2)                               --------->YAB1-
                                    --------->ARR11(3)--------->GLK1(2)              ------->GAMYB -
                                   <---------KAN1    --------->ARR14(2)              --------->AtMYB61
                                   --------->KAN4(1) <---------ARR14(2)       <---------ZAT2--------
                                   <---------KAN4(1) <---------GLK1(2)        --------->At4g35610  <
           <---------ICU4         <---------KAN4(2)<---------YAB1       <---------KAN1      --------
           <---------KAN1         ---------->TaMYB80<------ZmHOX2a(1)  <---------KAN4(2)--------->YAB1
           <---------AHL12(1)  ----------->GT1--------->ATHB12<---------WOX13(1)    --------->MYB46(3)
      <---------ATHB12   --------->ANAC58    <---------YAB1 --------->ATHB12  --------->ZAT2--------
    --------->WOX13(1)   --------->ANAC58 <---------RVE1(2)<---------YAB1     <---------At4g35610 --
 
tactgatcaatcgattatttcagagaacaagaaatggaatatactgatatgattaggattctgtgattggaaggaatgtccagctcaaccatcacaagta  8222200
===================HOX2a_HOX2a
<------ZmHOX2a(2)
-------->GATA12
---------GATA12
-------GT1
---->MYB52(1)
---MYB52(2)
->ANAC58                                                                                          <-
-------->RVE1(2)                                                                               <----
-------->ARR11(3)    --------->TOE2(3)                                                   <---------WOX13(1)
->ANAC58 <------ZmHOX2a(2)                                                  ----------->GT1---------
---------ARR11(3)    --------->YAB5         --------->ANAC58   --------->ANAC46         <-----------
->ANAC46<---------GATA12                    --------->ANAC58   --------->ANAC58         <---------WOX13(2)
->ANAC55(1) ------>ZmHOX2a(1)           -------->P     ------------>CBF<---------TOE2(3)--------->WOX13(2)
----->GAMYB--------->TOE2(3)  <----------DOF2  >>>>>>>>>>GT-3b --------->ANAC58       <---------AHL20(2)
 
acgatctaatcgatcctaaaacaacgtttaatgctttataaactaccaagaaaaatacaacaatacacgagattaagaaatgttataatgtaattgataa  8222300
                     <---------ANAC46
                     <---------ANAC58
            --------->AHL20(3)
            <---------AHL20(3)                              --------->DAG2
            <---------AHL20(2)                              --------->DOF5.7(1)
            <---------AHL25(3)                        <---------------AGL15
            --------->AHL20(2)                   =============================================bZIP_DOF
            <---------AHL25(2)                   <----------DOF2                       <-------TEIL
            --------->AHL25(1)                   <---------DOF5.7(1)                <---------ANAC58
   <---------TGA2(1) <---------ANAC58        --------->ANAC58           --------->ANAC58        ----
   --------->bZIP60(1)       <---------GLK1(2)------>NtERF2---------->DOF2          <---------TGA1a
   <---------bZIP60(1)<---------PCF2<---------MYB52(1)--------------->AGL15         <---------ANAC46
   --------->TGA2(1)<-------TEIL   <-------GAMYB<---------DAG2  <---------WRKY12    ================
--------ICU4--------->AHL25(2)   <---------YAB5 <---------DOF5.7(1)     --------->ANAC58<---------AtLEC2
-----WOX13(2)   <---------------AtSPL8 <---------ANAC46    ===================================bZIP_DOF
>YAB1       <---------AHL25(1)  ----------------------->TaNAC69(2)<---------WOX13(2)--------->TGA1a
-CBF       <---------KAN1    <------------CBF--------->ANAC58  ------------>CBF     <---------ANAC58
 
ctaatgacatcagaataaaatggtgcgtccaagattgtcgttgtttggacgccttttcttcaaaaagtcaatggaacgaaactccagacgtgcatggtgc  8222400
                                                  <---------YAB5
                                                 --------->WOX13(2)
                                                 <---------WOX13(2)
                                                 --------->AHL12(2)
                                                 <---------AHL12(2)
                                                <---------AHL25(3)
                                               --------->AHL20(1)
                                               <---------AHL20(2)
                                               <---------AHL12(3)
                                               --------->AHL25(2)
                                               --------->AHL20(2)
                                               --------->AHL25(1)
                                               <---------AHL25(2)
                                               --------->AHL25(3)
                                               --------->AHL12(1)
                      <---------AHL12(2)       <---------AHL12(1)
                     --------->AHL20(2)        <---------AHL25(3)
                     <---------AHL20(2)        <---------AHL25(1)
                     <---------AHL25(3)        --------->AHL12(3)
                    <---------ATHB12          --------->AHL12(3)
                    --------->AHL20(2)        <---------AHL25(2)
                  ------>MYB46(1)             --------->AHL25(2)
                --------->TOE2(3)             --------->AHL25(1)
              -------->P --------->AHL20(2)   --------->AHL25(3)      --------->AtMYB61         ----
           <---------MYB52(2)                 --------->AHL20(2)   ------>MYB83             <-------
       <-----------HVH21 <---------AHL25(3)  <---------WOX13(2)    ------>MYB46(1)          <-------
  ------------>CBF------>MYB83               --------->WOX13(2)  --------->AtMYB61       <---------MYB52(1)
------->RAV1(1) <---------MYB59          <------ZmHOX2a(2)       <---------MYB59        <-------GAMYB
=======================MYC_MYB         --------->WOX13(1)<---------ANAC46              <-----------RAV1(1)
 
aacaaaacaatgtcactaacctaataaataaaacaagtttatcgatcaaattaattatctgcgtaaaaccaaaccaaaacatttgtttctctgttgtttg  8222500
                                                     --------->LBD16
                                                     ------>NtERF2
                                                    --------->ATERF1(2)
                                                    <---------ATERF1(2)
                       -------->P                   <---------HSFB2a(2)                          <--
                       ------>MYB83                 --------->HSFB2a(2)                         ----
                       ------>MYB46(1)        --------->ARR14(2)                                ----
                       --------->MYB52(1)     --------->ARR11(2)                             -------
                      ------>ZmHOX2a(1)       <---------ARR11(2)           --------->SPL7(1) -------
                    --------->SPL7(1)       <---------DEAR3(2)           ----------->HVH21   <------
              <---------WRKY18(1)           <------MYB46(1)              <---------SPL7(1)   <------
             --------->WRKY38(1)            <------MYB83              --------->MYB52(1)     <------
------>ID1   ----------->HVH21             <---------DEAR3(1)       <---------ETT(1)      --------->HSFB2a(2)
--ANAC58     --------->WRKY12 --------->ALFIN1<---------ARR14(2) <-----------GT1          <---------HSFB2a(2)
--ANAC58  --------->ATHB12    <---------AtMYB61    <---------LBD16  ----------->HVH21------>NtERF2--
 
tctcaaactcaaatggttgaccgtcctaccgatgtggtcgtagaagtcggttcttccggcagaactattttccgaccggacgagactccgactccagaac  8222600
                             <---------ALFIN1
                            --------->ZAT14
                            <---------ZAT14
       ------>MYB83    --------->ARR11(2)
       ------>MYB46(1) <---------ARR11(2)
      ----------->RAV1(1)  ------>ZmHOX2a(1)
     --------->AtMYB61 <---------ARR14(2)
-------LBD16           --------->ARR14(2)
----->TOE1(2)      <------NtERF2
----->TOE2(2)     ------>NtERF2<---------LBD16     <---------DOF5.7(1)
-->ARR11(2)       <---------RAP2.6(3)             <----------DOF2
-->ARR14(2)      --------->ANAC46--------->LBD16  <---------DAG2
---GLK1(2)       --------->ATERF1(2)              <---------DOF5.7(1)                             --
---ARR14(2)      <---------ATERF1(2)             <---------DOF5.7(1)                        --------
---ARR11(2)      --------->DEAR3(1)         ----------->HVH21                             --------->KAN1
------->TOE1(1) <---------RAP2.6(2)     --------->DOF5.7(1)   --------->ZAT6             <---------RVE1(2)
 
ctcggagaccaacacaattgccgccagttcctgcaccggagaaaaaactgaccctttttgccttaagactcgctgttcttgagaaggtttttgagattcc  8222700
                                                                                     ------>ZmHOX2a(2)
                                                                                     --------->YAB5
                                                                                    <------ZmHOX2a(2)
                                                                                   <---------GATA12
                                                                                   --------->GATA12
                                                                                   --------->ARR14(2)
                                                                                   <---------ARR11(3)
                                                                                   <---------RVE1(2)
                                                                                   --------->ARR11(3)
                                                                                   <---------ARR14(2)
                                                                   <---------WOX13(1)<---------DOF5.7(1)
                            <---------ANAC58           --------->YAB1           <------MYB46(1)    -
                        <---------DOF5.7(1)            --------->TOE2(3)        <------MYB83     <--
                       <---------DOF5.7(1)           --------->ARR11(3)       --------->ALFIN1 <----
           --------->ATHB51 <---------ANAC58         <---------GATA12    <-----------RAV1(2)   <----
           --------->AHL20(2)                        --------->GATA12 <---------ANAC58         <----
          <---------YAB1<----------DOF2              <---------ARR11(3)<----------DOF2         <----
------->KAN1      <------ZmHOX2a(1)   <---------AHL20(2)    <---------YAB5    <--------P <---------TOE2(3)
->GLK1(2) --------->ICU4------>ZmHOX2a(1)           <---------CCA1(2) <---------ANAC58<----------DOF2
 
aacattctagttcattatttaggagtccttttcttgagttttaaattgtgttcttaaatcttaatcacagattgcttcagggttgggatctttaggtttc  8222800
          --------->KAN1
          <---------MYB46(3)
        <-------GAMYB
    <---------ALFIN1
  <---------PCF2
 <---------PCF5
 ----------->TCP11(1)     --------->ARR14(1)
 <---------TCP23         --------->GATA12
--------->ZAT18          --------->ARR14(2)                                   <---------YAB1
-------->ALFIN1          <---------RVE1(2)                   <---------MYB46(3)
---------RAV1(1)         <---------GATA12           --------->GLK1(1)   <---------YAB1
-----ANAC58              <---------ARR14(2)         <---------GLK1(1) --------->KAN1
-----ANAC46              --------->ARR11(2)        <---------GLK1(2) <---------YAB1             <---
-----ANAC58              <---------GLK1(2)<---------ZAT6     --------->MYB52(2)          --------->ZAT2
-----ANAC55(1)           <---------ARR11(2)   --------->MYB52(1) <---------At5g28300   <------ZmHOX2a(1)
 
gtgtgggccacggttgttcttcttggtggattcgctggaagtttagagataacagatttctggtttgttactgtgattcttgttattgaaggagctaggc  8222900
                                                                                                ----
                                                                                                ----
                                                                            <-----------HVH21   <---
                                                                         <---------ANAC46       <---
                                                                         <---------ANAC58      <----
                                                                         <---------ANAC58      <----
                                                   --------->HSFB2a(2)<---------ARR11(2)       <----
                                                   <---------HSFB2a(2)<---------ARR14(2)       -----
                                         <---------ZAT14              --------->ARR11(2)       -----
                                         --------->ZAT14              --------->ARR14(2)       -----
                                         <---------ZAT18             <---------MYB52(1)      ------>MYB83
             ------->PIF5                <-------TEIL        <---------ARR11(3)         <-----------GT1
       --------->ANAC58              --------------->AtSPL8  --------->ARR11(3)      <---------WOX13(2)
       --------->ANAC58       <---------KAN1      <---------LBD16   --------->LBD16  --------->WOX13(2)
       --------->ANAC46 --------->ZAT14  --------->ZAT18 --------->YAB1 --------->MYB52(2)   ------>MYB46(1)
-------DOF2  <-------PIF5 ----------->RAV1(1) --------->RVE1(2)   <---------LBD16    <---------AHL12(2)
 
ttttcagtagaagccacgagcttgaactgcagcatcagtctaagtacacaatctctggaatcaacatcttccggttccttgtcaaacaaattaaccaaat  8223000
<- Previous    Next ->

AGI:  At4g14280.1   
Description:  binding. similar to binding [Arabidopsis thaliana] (TAIR:AT5G18980.1); similar to binding [Arabidopsis thaliana] (TAIR:AT3G06210.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO71079.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN70618.1); contains InterPro domain Armadillo-type fold; (InterPro:IPR016024); contains InterPro domain Armadillo-like helical; (InterPro:IPR011989)
Range:  from: 8222513    to: 8225180    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version