AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
             <----------DOF2
            <---------DOF5.7(1)
        <-----------GT1
      --------->AHL12(1)
      <---------AHL12(1)                                        --------->YAB1           <---------YAB1
     --------->AHL12(2)                                    <---------DOF5.7(1)         --------->AHL12(1)
     <---------AHL12(1)          <---------ANAC46          <---------DAG2              --------->AHL25(1)
     <---------AHL12(2)        <-----------GT1             <----------DOF2             <---------AHL12(1)
     --------->AHL12(1)   <---------AHL20(2)              <---------DOF5.7(1)          <---------AHL25(3)
     --------->AHL25(2)   --------->AHL20(3)         <-----------GT1                   <---------AHL25(1)
     <---------AHL20(3)   <---------AHL12(3)      <---------WOX13(2)                   <---------AHL12(3)
     <---------AHL25(2)   <---------AHL20(3)      --------->WOX13(2)                   --------->AHL12(3)
     --------->AHL20(3)   --------->AHL12(3)      --------->AHL12(2)                   <---------AHL20(2)
 <---------AHL20(2)       <---------AHL25(1)      <---------AHL12(2)                  <---------AHL20(2)
--------->AHL20(2)      --------->AHL12(2)      --------->AHL25(3)                    --------->AHL25(3)
--------WOX13(2)    <----------DOF2             --------->AHL20(2)                   --------->AHL12(2)
------->WOX13(2)   <---------DOF5.7(1)          <---------AHL20(2)             <-----------GT1
>ARR14(2) <-----------GT1 <---------AHL25(2)   --------->AHL25(3)       ----------->GT1--------->AHL20(2)
 
caatttaaaattttctcttttctctttattttttttacgtctaagacatttttaattttctcctttatcaaaatactgtatataacttatttattttaga  7962000
                         --------->ARR14(2)
                         <---------ARR14(2)
                         <---------ARR11(3)
                         --------->GLK1(2)
                         --------->ARR11(3)
                    <---------At5g28300
                   <-----------GT1                --------->YAB5
                <---------AHL12(2)                --------->KAN1
               <---------AHL25(1)                 --------->ATHB12
               --------->AHL20(2)                 <---------ICU4
               <---------AHL25(3)                <---------YAB1
               <---------AHL20(3)                --------->ICU4
               --------->AHL25(1)                <---------ATHB12
               <---------AHL20(2)                <---------YAB5
               --------->AHL12(1)              <---------ICU4
               <---------AHL12(1)             --------->ICU4
               --------->AHL20(3)            <---------AHL20(3)
               --------->AHL12(3)            --------->AHL20(3)         ---------->DOF2
               <---------AHL12(3)            <---------AHL12(2)      --------->ANAC58
              <---------AHL20(2)             --------->AHL12(2)      --------->ANAC58
              --------->AHL25(3)            --------->YAB1        --------->TOE1(3)
             --------->AHL12(2)           --------->ARR11(3)      --------->TOE1(2)
           <---------AHL20(2)           <---------YAB1            --------->TOE2(2)
          --------->AHL25(3)         ===============================HOX2a_HOX2a
          <---------AHL20(2)   <---------AtLEC2--------->YAB1     --------->TOE2(3)    <------------
      <----------DOF2--------->ZAT6  <------ZmHOX2a(2)     --------->MYB59            <---------KAN1
     <---------DOF5.7(1)<---------ARR14(1)<---------ARR11(3) <------ZmHOX2a(1)  <---------ZAT6
 
aaatgttctcttttttatttatttacagtatcttgaatggatcaagataataatcattcgattaggaaacctaagcaaagttagtgagagtaagtactaa  7962100
                                                                     <------ZmHOX2a(1)
                                                                     --------->YAB5
                                                            --------->YAB1--------->WOX13(2)
                                                           <---------YAB1 <---------WOX13(2)
                                                          <---------AHL20(2)
                                                          --------->AHL20(2)
                                                          <---------AHL12(3)
                                                          --------->AHL25(1)
                                                          <---------AHL25(1)
                                                          <---------AHL20(3)
                                                          --------->AHL25(3)
                                                          --------->AHL20(3)
                                                          --------->AHL25(2)
                                               --------->ANAC55(2)  --------->ICU4
                                               --------->ANAC58   <---------ICU4
                                               --------->ANAC46   --------->YAB1     <--------------
                                    --------->AHL25(1)   --------->AHL12(2) ---------->DOF2<--------
                                    <---------AHL20(2)   --------->YAB1   <---------AHL12(2)
                                <---------MYB46(3)      <---------KAN1   --------->YAB1    <--------
                                ----------->GT1--------->ANAC58--------->YAB1     <------ZmHOX2a(1)
       <---------YAB1   --------->AHL12(1)    <---------LBD16  <---------ICU4 --------->DOF5.7(1)
---AtSPL8         ----------->GT1   <---------AHL25(1) ------->TEIL<---------TOE2(3) ---------------
 
gtaacatttgattatacagaaatgtaaaaaatcgatggtttaattcttctacggaacgaattttaataataaggattaataaagaggattagtactttat  7962200
                                                <---------LBD16
                                                <---------At5g28300
                                               <---------ICU4
                                               <-----------GT1
                                             --------->WOX13(2)
                                             <---------WOX13(2)                        ------>ZmHOX2a(2)
                                            <--------ATHB1                            --------->GLK1(1)
                                            <---------AHL25(3)                        <------ZmHOX2a(2)
                                            <--------HAHB4                           --------->GATA12
                                            --------->YAB1                           <---------GATA12
                                            -------->HAHB4                           --------->GLK1(2)
                                            --------->YAB5                           --------->ARR14(2)
                                 --------->GATA12                                    <---------AGP1
                         <---------ARR14(2) --------->ATHB51                         <---------ARR11(3)
                         --------->ICU4     <---------ICU4                           <---------ARR14(2)
                        <-------GAMYB      --------->AHL25(3)                       <------ZmHOX2a(1)
                       <---------MYB46(3)  <---------YAB1                         <---------TOE1(2)
                   --------->ANAC58        --------->AHL20(2)                    --------->LBD16
                   <---------ANAC55(2)     --------->ICU4                       <---------TOE2(1)
                   <---------RAP2.6(2)     <---------AHL12(1)                   <---------TOE1(1)
                   --------->ANAC58        <---------ATHB51                    ------>ZmHOX2a(2)
                  --------->RAP2.6(3)      --------->AHL12(1)                 =============HOX2a_HOX2a
                <---------ARR14(2)        <---------AHL12(2)                  <------ZmHOX2a(2)
                <---------MYB52(1)        --------->AHL12(2)                 --------->ARR11(2)
                --------->ARR11(2)      >>>>>>>>>GT-1                        <---------ARR14(2)
                <---------ARR11(2)   <------MYB83                            --------->ARR14(2)
                --------->ARR14(2)   <------MYB46(1)                         --------->GATA12
               <-----------HVH21 <---------ARR11(2)                          <---------GATA12
               <-------GAMYB     <---------RVE1(2)                           <---------ARR11(2)   --
              <---------DEAR3(2) --------->ARR14(2)                  --------->ANAC58--------->ARR11(2)
              <---------MYB46(3) <---------ARR14(2)                --------->MYB52(1)--------->ARR11(3)
-AtSPL8      <---------DEAR3(1)  <---------GATA12                  --------->ARR11(2)<---------ARR11(2)
-DAG2        <---------ANAC46    --------->ARR11(2)                <---------ARR11(2)<-----------ARR10
--DOF2     ------------>AtMYB77 <------ZmHOX2a(1)<---------RAP2.6(2) --------->ANAC58--------->RVE1(2)
>AtSPL8    ------------>MYB.PH3(1)   ----------->GT1        <---------KAN1  <---------GLK1(1)  -----
 
acacatgagacaagaggcggttacggcagttatgaggatttggttaataattacggcgttagaattaggggaacggaagggatccgaggatctcaacata  7962300
                                                                  --------->TOE1(3)
                                                                  --------->TOE2(3)
                                                                <---------TOE1(3)
                                                       <---------ANAC58
                                                       <---------TGA1a
                                                       <---------O2                     ----------->TBP
                                                       --------->TGA1a                 --------->ARR14(2)
                                                       =================================bZIP_DOF
                                                       --------->O2                 <---------ANAC58
                                                       <---------ANAC46             <---------ANAC58
                                ------->GAMYB          <---------ANAC58             <---------ANAC46
                                =================================MYC_MYB        <------------CBF
                               <---------MYB52(2)     <------NtERF2--------->DOF5.7(2) <---------ARR14(2)
                 <------ZmHOX2a(2)                   <---------RAP2.3(1)       --------->ATHB12    <
                <---------ARR11(3)          <---------MYB52(1)  <---------TOE2(3)   <---------ANAC55(1)
          ----------->GT1      --------->MYB46(3)   <---------DEAR3(1)<---------TOE2(3)--------->ARR11(2)
        >>>>>>>>>ARR1        ----------->RAV1(1)    <---------RAP2.6(2)      <----------DOF2       -
        >>>>>>>>>ARR2 --------->DAG2       ======================MYC_MYB--------->TOE2(3) ----------
      <---------YAB1 ---------->DOF2       <-------GAMYB --------->ALFIN1    <---------DAG2   ------
      <---------TOE2(3)     <----------ID1<---------ANAC46     <---------DOF5.7(2)  <---------ANAC55(2)
--------->MYB46(3)   ============================================bZIP_DOF<---------MYB52(1) <-------
------->MYB52(1)--------->ARR11(3)   --------->KAN1--------->At4g35610<---------TOE1(3)<---------ARR11(2)
---->RVE1(2)    --------->RVE1(2)  --------->YAB1 --------->MYB52(1) <---------DOF5.7(2)<---------KAN1
 
tcaacggctaagattgtaagatcaaaaagtagcaacaaacatattccgttaagtagcggcgtgtgttaacgttaacgttactttattgcgtatatataaa  7962400
                        --------->ZAT6
                       --------->ZAT18                                                     ---------
                       <---------ZAT18                                                   --------->DOF5.7(1)
                     <---------ZAT14                                                --------->LBD16
                <---------ANAC58                                                   <---------------AGL15
         <---------ANAC58     --------->GATA12                                     --------->HSFB2a(2)
         <---------ANAC58     <---------GATA12                                     <---------HSFB2a(2)
------------>AtMYB77 <---------ZAT18                                    --------->LBD16  --------->DAG2
---------ARR11(2)    --------->ZAT14            <<<<<<<<<TBF1  <-----------GT1    ----------------->AGL3
-------->ARR11(2)    --------->ZAT18         <<<<<<<<<TBF1 <----------DOF2        <---------LBD16
->TBP    <---------ANAC46  *TSS         <---------DOF5.7(1)<---------DAG2 <---------MYB52(1)   <----
--->MYB52(1)    <---------ANAC58      XXXXXXXXXXXXXXXXXXXX>MIR847      --------->LBD16  ---------->DOF2
--AHL20(2)    <---------RVE1(2)   <-----------HVH21<<<<<<<<<TBF1      <---------LBD16   --------->DOF5.7(1)
 
cggagacggtttccttggagcttgtgcacactaaatctgtcactcttcttcttcttcttctacttttctctctcccggttattttcccagaaaaagtgcg  7962500
             <----------DOF2
        --------->WRKY12
       <---------MYB52(1)
      <-------GAMYB
     <---------ANAC46                                      <---------GLK1(2)
 --------->KAN4(2)                                 <---------DOF5.7(1)
--------->HSFB2a(1)                            <------NtERF2
<---------HSFB2a(1)                          <---------ANAC46
--------->KAN1                               <---------ANAC58
<---------HSFC1(2)              ---------->DOF2--------->ATERF1(1)
--------->HSFC1(2)        >>>>>>>>>TBF1      <---------ANAC58                                     <-
>TOE1(2)--------->WRKY38(1)  >>>>>>>>>TBF1   <---------bZIP60(1)                          ----------
-----HSFB2a(2)         >>>>>>>>>TBF1         --------->bZIP60(1)            <-----------RAV1(1)   --
 
agaaaattccgttgagctttagagaagaagaagaagaaagcttcaatggcgtcgtcttctcagaaactgatcagtgtttgtgtcgctgtgctcgtcgtct  7962600
                                                                          <-----------GT1
                                                                       <---------DOF5.7(1)
                                                                      <---------DOF5.7(1)
                                                                --------->HSFB2a(1)
                                                                <---------HSFB2a(1)
                                                                <---------HSFC1(2)
                                                                --------->HSFC1(2)
                                                                <---------KAN1
                                                               <-----------ARR10
                                                               ------->TEIL---------->ID1
                                                               <---------ARR11(1)
                                                               <---------ARR14(2)
                    --------->LBD16                            --------->ARR14(2)
           ----------->ARR10                                   --------->GATA12
           --------->ICU4                                     <---------ARR14(1)
           <---------YAB1                                     <---------CCA1(2)
        <---------DEAR3(1)     --------->GATA12            --------->HSFC1(1)
     --------->ANAC46    ----------->GT1                   --------->HSFB2a(2)               <------
  ----------->HVH21--------->ANAC55(2)                     <---------HSFB2a(2)<---------DOF5.7(1)
 <-----------HVH21 <---------HSFB2a(2)           <---------DOF5.7(1)  <----------DOF2     --------->AHL12(2)
--------At4g35610  --------->HSFB2a(2)          <----------DOF2--------->ARR11(2)     --------->YAB5
>ID1<---------LBD16--------->ANAC46            <---------DOF5.7(1)   <---------DOF5.7(1) <---------AHL20(2)
------->At4g35610 <---------LBD16            <---------ARR11(3)<---------GATA12<----------DOF2
 
tagctctcacggcgatgattttccggaacagtgaaatctctctctctaggtctttttctcttctcgaatcttccttttttctctttcgatgtttatttat  7962700
                                                                 --------->HSFB2a(1)
                                                                 <---------KAN1
                                          --------->AHL12(2)     <---------HSFB2a(1)
       ---------->ID1                ----------->GT1             <---------HSFC1(2)          <------
       <---------MYB52(1)        <-------TEIL         --------->ATHB12                <---------GATA12
      <-------GAMYB           <---------At4g35610     --------->YAB5            --------->MYB52(2)
     <---------ANAC46         --------->At4g35610    <---------YAB5<-----------GT1    --------->GATA12
     <---------ANAC58  <----------DOF2--------->TOE2(3)--------->ARR11(3)       <---------MYB46(3)
     <---------ANAC58  <---------DOF5.7(1)--------->WOX13(2)     --------->HSFC1(2)   ------->TEIL
  <---------MYB52(1)  <---------DOF5.7(1) <---------WOX13(2)    <---------KAN4(2)<-------GAMYB
-----GT1             ----------------->AGL3         <---------WOX13(1)        <---------MYB52(1)
 
cttctgtttcgttgtttttaagtctcctttttaagctgcattgttaatttctgtgaatgattttgagaattttccatctctgtttgttgaatctcgcttc  7962800
                                                    --------->AHL12(1)
                                            <---------ARR11(3)
                                            <---------AGP1
                                            --------->ARR11(3)
                                            <---------ARR11(2)
                                            --------->ARR11(2)
                                   <---------------AGL15
                                   --------------->AGL15
                                  <-----------------AGL2
                                  ==================================================================
                                  ----------------->AGL3
                               <----------DOF2      <---------AHL12(1)                          ----
                              <---------ANAC58====================HOX2a_HOX2a                   <---
                         <---------GATA12   <---------ARR14(2)                               -------
                         <---------GLK1(2)  --------->ARR14(2)                              --------
                         --------->ARR14(2) <---------RVE1(2)         <---------YAB1        --------
      --------------------->WRI1  <-----------------AGL3        <---------YAB1           <---------At4g35610
      <----------DOF2  ----------->ARR10    <---------GATA12    <---------MYB52(1)       --------->At4g35610
     <---------DOF5.7(1) --------->GATA12   --------->GATA12  <---------ZAT6        --------->YAB1
 <-------TEIL  <-----------GT1<---------ANAC58------>ZmHOX2a(2)<-------GAMYB--------->ARR11(3)  ----
----DOF2  ---------->ID1 <---------RVE1(2)  ------->TEIL   <------ZmHOX2a(1)<---------ARR11(3)  <---
 
acgattcatctttgtttttttcttcttagatttgctttctgtttatggatcttgaaattttaggactgttattgtgaaagatttcaattttaagctccag  7962900
<- Previous    Next ->

AGI:  At4g13710.1   
Description:  pectate lyase family protein. Identical to Probable pectate lyase 15 precursor [Arabidopsis Thaliana] (GB:Q944R1;GB:O23668;GB:Q9SVP1); similar to pectate lyase family protein [Arabidopsis thaliana] (TAIR:AT1G04680.1); similar to pectate lyase family protein [Arabidopsis thaliana] (TAIR:AT3G24230.1); similar to pectate lyase family protein [Arabidopsis thaliana] (TAIR:AT3G07010.1); similar to unknown [Populus trichocarpa] (GB:ABK96205.1); similar to pectate lyase [Prunus persica] (GB:BAF43573.1); similar to unknown [Populus trichocarpa] (GB:ABK95980.1); contains InterPro domain Pectin lyase fold (InterPro:IPR012334); contains InterPro domain
Range:  from: 7962428    to: 7966457    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version