AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                   --------->TOE1(2)
                                                                 --------->RVE1(2)
                                                                 <---------GATA12
                                                                 --------->GATA12
                                                                 --------->GLK1(2)
          --------->AHL20(3)                                     <---------ARR11(3)
          <---------AHL20(3)                                     --------->ARR14(2)
      ----------->GT1                                            <---------ARR14(2)
     ----------->GT1                   --------->YAB5            --------->ARR11(3)
   ---------->DOF2---------->DOF2      --------->ATHB12 ------>MYB83            <----------DOF2
--------------AGL15    <----------DOF2 <---------ICU4--------->ANAC58          <---------ANAC58
---------DOF2--------->RVE1(2)        <---------ATHB12<---------MYB59          <---------ANAC58  ---
------------->AGL15--------->DAG2     --------->MYB46(3)------>MYB46(1)      ------->TEIL      -----
->GATA12  --------->AHL12(2)     --------->ANAC58    --------->ANAC46     <---------KAN1  --------->REM1(1)
--GATA12  <---------AHL12(2)     --------->ANAC58    --------->ANAC58--------->LBD16   --------->TOE2(3)
 
cctttaaaaagataaaaatcaaaaagcttttcagagaggcaaccattgctatccaaacccaacttcaaaatctgggaatgtagctttcttccttcatcta  7942500
                                                                          --------->ANAC55(1)
                                                                          --------->ANAC46
                                                                          --------->ANAC58
                                                                          --------->ANAC58
                                                           <---------KAN1<---------LBD16
                                                    <------MYB46(1)      --------->LBD16
                            --------->ANAC58        <------MYB83        <---------ALFIN1
                            --------->ANAC58       --------->MYB59     <---------REM1(2)
                        <---------HSFB2a(2)    --------->ATHB12   --------->ARR14(2)               <
                     ------>ZmHOX2a(1)         <---------ICU4     <---------GLK1(2)                -
        ---------->ID1  --------->HSFB2a(2)    --------->YAB5    --------->YAB5         <----------DOF2
------>DOF5.7(1)    --------->TOE2(3)         <---------YAB1    --------->ANAC46       <---------DOF5.7(1)
----->DOF2      --------->KAN1                --------->ICU4   --------->LBD16 <---------YAB5      <
 
aagacccatttgtcttcaaacatccttcaagaagccatttcaaagtttgatgattaggtcgaattccacgattctccacggaatcaattctcttttcttg  7942600
                                                            --------->DOF5.7(1)
         ------>ZmHOX2a(1)                                ---------->DOF2
        --------->TOE2(3)                              ----------->RAV1(1)
    --------->KAN1         ---------->DOF2          --------->PCF5
   <-------TEIL           --------->CCA1(2)         <---------TCP15(1)
--------->ATHB12         <---------RVE1(2)          --------->PCF2                              <---
-------->HAHB4           --------->ARR11(3)        <-----------HVH21                            ----
--------->YAB5           <---------ARR14(2)      ------>ZmHOX2a(1)                ----------->GT1
---------YAB1   --------->CCA1(2)              ====================RAV      <------ZmHOX2a(1)-------
-------->ICU4  <---------ARR11(3)              ----------->RAV1(2)      --------->DOF5.7(1)---------
---------ATHB12--------->ARR11(3)--------->At4g35610<---------TCP20   ---------->DOF2<-----------GT1
 
aaatgattcatcctcagagatataaacagatatagcagcaaaactagctctcctggtcccacaaagagtctacaaaagaggagcatagttacaaaatcag  7942700
                                                             ---------->DOF2
                                                            <------ZmHOX2a(1)
                                                           --------->ANAC46
                                                    --------->YAB5
                                                    --------->YAB1                    <---------TOE2(1)
                                                    <---------ICU4                    <---------TOE1(1)
                                                   --------->ICU4                --------->At4g35610
       --------->ANAC58                            <---------ATHB12              <---------At4g35610
     ---------->DOF2                              --------->ANAC58   <---------ARR11(2)
------ARR11(2)                                    --------->ANAC58   --------->ARR11(2)           <-
----->ARR11(2)                                --------->ANAC58       --------->ARR14(2)   <------ZmHOX2a(1)
-->YAB1--------->ANAC58                       --------->ANAC46       <---------ARR14(2) --------->ANAC46
>RVE1(2)                     --------->ATHB12 --------->ANAC58 --------->DOF5.7(1)    <---------ANAC46
 
aaccatgttaaagcaatggagtttcaatgggatgatttagagaacaagaacgcaagcattacaggaaagacagttctggtcttgagcttacgaggaacac  7942800
                                                                                  --------->AHL25(3)
                                                                                 --------->AHL12(2)
                                                                               --------->AHL12(1)
                                                                               <---------AHL12(1)
                                                                               --------->AHL25(1)
                                                                               <---------AHL20(2)
                                                                               --------->AHL12(3)
                                                                              <---------AHL25(2)
                                                                              --------->AHL25(3)
                                                                              --------->AHL25(1)
                                                                              <---------AHL20(3)
                                                                              --------->AHL25(2)
                                                                              <---------ARR11(3)
                                                                              --------->ARR11(3)
                                                                              --------->AHL12(1)
                                                                              <---------AHL20(1)
                                                                              --------->AHL20(1)
                                                                              <---------AHL12(1)
                                                                              --------->AHL20(2)
                                                                              --------->AHL20(3)   -
                                                                              <---------AHL25(1)   -
                                                                              <---------AHL20(2)   <
                                                                              <---------AHL25(3)   <
                                                                             --------->AHL20(2)  <--
                                                                             --------->AHL12(3)  ---
                                                                           ------>MYB46(1)       ---
                                                                         ------->GAMYB           ---
                                                                        --------->MYB46(3)       <--
                                                                       ------>MYB83<---------AHL20(2)
                                                                       ------>MYB46(1)           ---
                                                 ------>ZmHOX2a(1)     -------->P<---------AHL12(3)-
                                                --------->TOE2(3)    --------->AtMYB61           <--
                                               <---------DOF5.7(1)   <---------MYB111(1)         ---
                  --------->ANAC58            ------>ZmHOX2a(1)     --------->MYB46(3)           <--
                  --------->ANAC58        --------->ARR14(2)        <---------MYB55(2)           ---
                <------ZmHOX2a(1)         <---------ARR14(2)        --------->DEAR3(2)           <--
     ----------->GT1                      <---------ARR11(2)       ------->TEIL<---------AHL12(3)---
   --------->YAB5--------->SPL7(1)        --------->ARR11(2) --------->DOF5.7(1) --------->AHL12(3)<
--------YAB1 --------->YAB5          --------->TOE2(2)     ---------->DOF2 ------>MYB83     --------
 
catgaatgaagataaatgaggacgacactgagcgaagaaacatgggttcctccttagaatgccaaagacgaaccaaccaaatatatttattcatgtggaa  7942900
   <---------YAB1
  --------->ARR11(3)                                                                <---------YAB1
  <---------ARR11(3)                                                            <---------AHL12(2)
-------->AHL25(2)                                                               --------->AHL20(3)
-------->AHL20(3)                                                               --------->AHL20(1)
---------AHL20(3)                                                               <---------AHL25(2)
---------AHL25(2)                                                               --------->AHL25(2)
-------AHL20(3)                                    <---------WOX13(2)           <---------AHL20(3)
------>AHL12(1)                                    --------->WOX13(2)          <---------ICU4
------>AHL20(3)                                   <---------ICU4             <---------AHL12(3)
------>AHL25(2)                          <---------TOE1(3)                   <---------AHL12(2)
-------AHL25(2)                          <---------TOE2(3)                   --------->AHL12(2)
------>AHL25(3)                         ---------->DOF2                      --------->AHL12(3)
-------->AHL12(2)                      <---------AHL20(2)                   <---------AHL20(2)
-------AHL20(1)                     <---------WOX13(2)           --------->KAN1--------->AHL12(1)
------>ICU4                         --------->WOX13(2)       <------ZmHOX2a(1)--------->ICU4
-------AHL12(1)                    ==============================MADS_MADS  <---------ICU4         -
------>ARR11(3)                    --------------->AGL15    ----------->GT1 <---------AHL25(3)    <-
-------ARR11(3)                  ------------>CBF<---------------AGL15     --------->AHL20(2)     <-
------>AHL20(1)                 <-----------GT1  --------------->AGL15   --------->YAB1         ----
---------AHL12(2)         <---------AtMYB61     <-----------------AGL2--------->TOE2(3)         <---
--->GT1             <---------AtMYB61 --------->AHL20(2)   ----------->GT1--------->AHL12(2) -------
 
aatattatcttcgaaattttgttttggttttggtttttcaatttaaagtttactaattaggggaggaaaaattccataataaatattatgtttttttcat  7943000
                                                                                 <---------AHL20(2)
                                                                               --------->AHL20(2)
                                                                               --------->AHL12(3)
                                                                               <---------AHL20(2)
                                                                               <-----------TBP
                                                                             <-----------TBP
                                                                             <---------AHL12(3)
                                                                             --------->AHL12(3)
                                                                             --------->AHL20(2)
                                                                           --------->AHL20(2)
                                                                           <-----------TBP
                                                                           <---------AHL20(2)
                                                                           --------->AHL12(3)
                                                                           <---------AHL12(3)
                         <---------------AtSPL8                          --------->AHL20(2)
                         --------->DAG2                                  <---------AHL20(2)
                        ---------->DOF2                                  <-----------TBP
                   <------------CBF                                      <---------AHL12(3)
           --------->AHL12(2)                                            --------->AHL12(3)
           <---------AHL12(2)                                          <---------AHL20(2)
          --------->AHL12(1)                                           --------->AHL20(2)
          <---------AHL12(1)                                           <-----------TBP
          --------->AHL12(3)                                           <---------AHL12(3)
          --------->AHL25(2)                                           --------->AHL12(3)
         <---------AHL20(2)                                          --------->AHL20(2)
         --------->AHL12(3)                                          <---------AHL20(2)
         --------->AHL20(2)                                        <---------AHL12(3)
         <---------AHL25(1)                                        <-----------TBP
         --------->AHL25(1)                                        --------->AHL20(2)
         <---------AHL25(3)            <------------CBF            <---------AHL20(2)
         --------->AHL25(3)      <---------MYB46(2)                --------->AHL12(3)
         <---------AHL25(2)      --------->DEAR3(1)              <---------AHL12(3)
         --------->AHL25(2)     --------->ANAC58                 --------->AHL12(3)
         <---------AHL20(1)     --------->ANAC58                 --------->AHL20(2)             <---
         <---------AHL12(1)     --------->ANAC46                 <---------AHL20(2)   --------->YAB1
-------->YAB1    <---------RVE1(2) ------>MYB83                <-----------TBP <---------AHL12(3)
--------YAB5    --------->ANAC55(2)------>MYB46(1)          --------->TOE2(3)<---------AHL20(2) ----
--------YAB1  <-----------GT1<-------TEIL             <-----------GT1--------->AHL12(3)    <--------
----->YAB1<---------AHL12(3) <---------ZAT14       --------->WOX13(2)<---------AHL12(3) <---------YAB1
------ICU4<---------AHL25(3) --------->ZAT14       <---------WOX13(2)<-----------TBP  --------->YAB5
-->YAB1  --------->AHL12(1)  --------->ZAT18    ------------>CBF <-----------TBP <---------AHL12(3)
 
aatcatacataaaaaatttacatattgaaaagtacaccgaactattgtttactcaatttacaacctatatatatatatatatatatatatgatgatgtta  7943100
                 <-------MYC2
                 ------->MYC2                         <---------ANAC55(2)
                 ------->MYC3                    <---------YAB1                                    <
              <---------ANAC58                <---------YAB1                                  ------
    ----------->GT1                         --------->YAB1                                    ------
------ANAC55(2)  <-------MYC3               --------->YAB5                                    <-----
----->ANAC55(2) <---------KAN1             <---------YAB1   ---------->DOF2                  -------
-YAB1         <---------ANAC58        --------->RVE1(2)   <---------YAB1   <---------ANAC55(2)<-----
 
agtgagagcgtttaatagcatgtgtaaagttttgggtttagtatctatgatgatgttaagtatgaaagatagctaatctcgtaagagtttagaagagtgg  7943200
                                                                                        <---------ANAC46
                                                                                        <---------ANAC58
                                                                                      <---------MYB46(3)
                                                                                      --------->MYB55(2)
                                                                          <---------AHL25(3)
                                                                          <---------AHL20(2)
      ----------->GT1                                                    --------->AHL20(2)
    <---------GLK1(1)                                                    <---------AHL25(1)
  <------ZmHOX2a(1)                                                      --------->AHL25(1)
-----------RAV1(2)                                         --------->AHL20(2)     <---------AtMYB61
--->ZAT14                                                  --------->YAB1<---------AHL20(2)
--->ZAT18                                              <---------YAB1   --------->AHL12(2)
----ZAT18                <---------KAN1              <-----------GT1    <---------AHL12(2)
-->ALFIN1              <---------ANAC46      ----------->GT1         --------->AHL20(2) <---------ANAC58
----ZAT14   <---------YAB5                <---------At4g35610    ----------->GT1  --------->ALFIN1 <
 
agtcaggaaatgtgaatcagtgaatggagtatgaagtagggtttgtgctggtaatattacaataaaactcgtataaataaatgagatggtggtttgtgtt  7943300
                                       --------->AHL20(2)
                                       <---------AHL20(2)
                                       <---------AHL12(3)
                                       <---------AHL25(1)
                                       <---------AHL25(3)
                                       --------->AHL25(1)
                                      <---------AHL25(1)
                                      --------->AHL20(1)
                                      --------->AHL25(1)                 --------->MYB52(2)
                                      <---------AHL20(2)                 <---------MYB46(3)
                                      --------->AHL20(2)            <---------------AtSPL8         -
                                      <---------AHL20(1)     <-----------------AGL3        ---------
                                      <---------AHL12(1)    <-------TEIL <---------ANAC58  <--------
                                      <---------AHL25(2) <------MYB83    <---------ANAC58  <--------
                           <---------ANAC46              <------MYB46(1)--------------->AtSPL8<<<<<<
                           <---------ANAC58             --------->MYB59 <-------TEIL       ---------
              --------->ARR14(2)      --------->AHL25(2)--------->MYB46(2)              --------->GLK1(2)
              <---------ARR14(2)      --------->AHL25(3)--------------->AtSPL8        --------->KAN1
             --------->KAN1<---------ANAC55(1)          --------->MYB111(1)          --------->ARR11(3)
        <---------At4g35610<---------ANAC58       <---------ZAT14<---------AHL20(2)  <---------ARR11(3)
<----------DOF2  <-----------GT1<-----------GT1 <---------YAB1  --------->AHL20(2)   <---------RVE1(2)
---------DOF5.7(1)<---------At5g28300 --------->AHL12(1)<---------------AtSPL8       --------->ARR14(2)
 
tctctttgttcagcccatattcactgtatttcgtgtaacaatttatttgtgactatagtttggtacattatatggttcgttccatctagatattctagaa  7943400
<- Previous    Next ->

AGI:  At4g13650.1   
Description:  pentatricopeptide (PPR) repeat-containing protein. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT5G09950.1); similar to pentatricopeptide, putative, expressed [Oryza sativa (japonica cultivar-group)] (GB:ABA99524.2); similar to hypothetical protein OsJ_035025 [Oryza sativa (japonica cultivar-group)] (GB:EAZ20816.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO23492.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 7938963    to: 7942894    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version