AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                           <---------DOF5.7(2)
                                                                          <---------WRKY12
                                       <----------ID1                     <---------WRKY38(1)
                                     --------->MYB52(1)                  --------->DOF5.7(2)
                                ---------->DOF2                         <-----------HVH21
                               --------->AHL25(1)                    --------->DOF5.7(1)
                              <---------KAN1                <---------ARR11(2)
                         <------ZmHOX2a(2)                  --------->ARR11(2)                 -----
                        --------->GATA12                    --------->ARR14(2)               <------
                        <---------GATA12                 <---------HSFB2a(2)    --------->ANAC58
                        --------->RVE1(2)      <----------ID1      ---------->DOF2      <---------GATA12
-------->YAB1           --------->ARR11(2)  ---------->DOF2 <---------ARR14(2)  --------->ANAC58
------>RVE1(2)  --------->RVE1(2)<---------TOE2(3)       --------->HSFB2a(2) --------->ANAC46-------
 
aatcaaaactttgttccactatcaacagatcgaattaaagtaacgacaaaagaacaagacccagaaccccaaaagcgtcaacgaagcaatacatctaata  6853500
                         ------->GAMYB
                 --------->ARR11(3)                                                       ------>ZmHOX2a(2)
                 <---------ARR11(3)         <---------AHL12(3)                            <---------DEAR3(1)
                --------->YAB1              --------->AHL12(3)                           <------ZmHOX2a(2)
               <---------YAB1               --------->AHL20(3)                          <---------ARR11(2)
             --------->YAB5                 <---------AHL20(3)                          --------->GATA12
        --------->DOF5.7(2)               <---------YAB1                                --------->ARR14(2)
       <----------DOF2 <---------TOE2(3) --------->AHL25(2)                   <---------ANAC58
      --------->YAB5  <-----------GT1----------->GT1                          <---------ANAC58
     <---------ATHB12 --------->MYB52(1) <---------AHL25(2)             <-----------RAV1(1)        -
----->DOF2<---------DOF5.7(2)  <------ZmHOX2a(1)       <---------ZAT14 <---------RVE1(2)<---------ARR14(2)
---WOX13(2)<---------TOE2(3) --------->ANAC58          --------->ZAT14 <---------TOE2(3)<---------GATA12
-->WOX13(2)<---------TOE1(3) --------->ANAC58   <-----------GT1  <---------RVE1(2)      --------->ARR11(2)
 
aagtttcaatctttaacgatgatattaacggtaaggaagagagttatatttataccagtgaagttatcgattttgatgttggcctgagcacgatcggcga  6853600
               --------->ARR14(2)
               <---------ARR14(2)
               --------->ARR11(2)
               <---------ARR11(2)
               <---------GATA12
               --------->GATA12
       <------NtERF2
      ------>NtERF2
     --------->RAP2.3(2)
    <------NtERF2
    --------->ATERF1(1)
    --------->RAP2.3(1)
    --------->RRTF1(1)
   <---------ERF1------>ZmHOX2a(2)
   <---------ORA47(2)
   <---------RAP2.3(1)
   <---------DEAR4(2)
   <---------RRTF1(1)
   <---------ATERF1(1)
   ------>NtERF2<------ZmHOX2a(2)
   <---------RAP2.6(1)
  <---------DREB2C(2)
  <---------RAP2.3(3)
  <---------RAP2.3(2)
  <---------RAP2.6(2)
  <---------RRTF1(2)               <---------ANAC46                              <----------DOF2
  --------->ALFIN1            <----------DOF2                        --------->HSFB2a(2)
  <---------DEAR3(1)         <---------ANAC58   ------->GAMYB        <---------HSFB2a(2)         ---
  <---------RRTF1(3)         <---------ANAC58 --------->At4g35610    --------->HSFC1(1)<----------DOF2
 --------->ATERF1(1)   <---------WRKY12     <---------WRKY38(1) <---------YAB5  <---------DOF5.7(1)
-------->DOF5.7(1)  --------->ANAC46 <---------KAN1----------->RAV1(1)   ---------->DOF2      <-----
 
agaaggcggcgcaattgggatccaagtcaatggctttggagtataagtcaacagcaacatcgaagtcatcatctagaaaagcttctttagctttctctgc  6853700
                           --------->GATA12
                           <---------GATA12
             <---------RVE1(2)
            --------->YAB5 <---------ARR11(2)
            --------->KAN1 <---------ARR14(2)
     <xxxxxxxxxxxxxxxsmallRNA(le3)
  <---------ANAC58        <------ZmHOX2a(1)    <-----------HVH21                    --------->GLK1(2)
  <---------ANAC58  <---------YAB1            --------->ANAC58             --------->DOF5.7(1)
------>KAN1<---------ATHB12--------->ARR14(2) --------->ANAC58           ---------->DOF2     ------>ZmHOX2a(1)
----At4g35610<---------GLK1(2)                --------->ANAC46   <---------YAB1    <---------GLK1(2)
 
taattccttggccattgattcttatcagaggatttgagagaacacaaacaagtcagagagagagagagattatagagaaagagaccgattctattcctct  6853800
                                                                                                 ---
                                                                                                 <--
                                                                                                 <--
                                                                                                 ---
                                                                                                 <--
                                     <----------DOF2                                        <-------
                            --------->AHL12(2)                                              --------
                            <---------AHL25(2)                                         --------->DOF5.7(1)
                            --------->AHL25(1)                                         --------->DAG2
                            <---------AHL12(3)                                        --------->DAG2
                            <---------AHL20(2)                                        --------->DOF5.7(1)
 <---------DOF5.7(1)       --------->AHL12(1)          *TSS       <-----------HVH21  ---------->DOF2
<----------DOF2          <---------RVE1(2)        --------->AHL20(2)     <-----------GT1----------->GT1
 
aggctttttttttttttgctgtgtttgggattttttttttcttttaagaacgttttaatacctctactaggtcatataaccaaaaacaaaaaggtaatta  6853900
                                                                                  <---------AHL12(2)
                                                                                 <---------AHL20(2)
                                                                                 --------->AHL20(3)
                                                                                 --------->AHL20(1)
     --------->AHL20(3)                                                          <---------AHL20(1)
     --------->AHL12(3)                                                          --------->AHL20(2)
     --------->AHL20(2)                                                          <---------AHL12(3)
     <---------AHL20(2)                                                          --------->AHL25(2)
     <---------AHL20(3)                                                          --------->AHL25(3)
     <---------AHL25(2)                                                          <---------AHL20(3)
     <---------AHL25(1)                                                          <---------AHL25(2)
     <---------AHL25(3)                                                          --------->AHL12(1)
     --------->AHL25(3)                                                          <---------AHL12(1)
     <---------AHL20(1)                                                          --------->AHL25(1)
     --------->AHL25(2)                                                          <---------AHL25(1)
     --------->AHL25(1)                  --------->TOE1(2)                       <---------AHL25(3)
--------->AHL25(2)                       --------->TOE2(2)                      --------->AHL25(1)
<---------AHL25(2)                      --------->YAB1                          <---------AHL25(1)
--------->AHL20(2)           <---------AHL20(3)                                 --------->AHL20(2)
<---------AHL20(2)           --------->AHL20(2)                                 <---------AHL20(2)
--------->AHL25(3)           --------->AHL20(3)                                 --------->AHL12(3)
<---------AHL25(1)           <---------AHL20(2)                                 --------->AHL25(3)
--------->AHL20(3)           --------->AHL25(1)                           <-----------GT1
<---------AHL20(3)           <---------AHL25(1)   <---------RVE1(2)    <---------AHL12(2)
--------->AHL25(1)           --------->AHL25(3)  --------->KAN1      <---------AHL12(1)
------>ARR11(3)              <---------AHL25(2)  --------->YAB5      --------->AHL12(1)
-------ARR11(3)              --------->AHL25(2)<---------WOX13(1)   <---------RVE1(1)
-------RVE1(2)          <---------YAB1 >>>>>>>>>MYB98              <---------ARR11(3)
------>GATA12        <----------DOF2  <-----------GT1              --------->GATA12
-------GATA12    <-----------GT1--------->AHL12(2)<---------GLK1(2)<---------ARR14(2)             --
--WOX13(2)     --------->WOX13(2)  <---------AHL12(2)              --------->ARR14(2)         ------
->WOX13(2)<-----------GT1 <---------RVE1(2)   <------------CBF     <---------GLK1(2)   --------->WOX13(2)
 
gattttattttattttctaatttccttttgattttattttttaacataagattgattcttgataagtccagattttttaacaaataaattagttgacaaa  6854000
                                                                      <--------HAHB4
                                                                      --------->YAB1
                                                                     --------->ICU4
                                                                     <---------YAB5
                                                                   --------->YAB1
                                                                  --------->AHL12(1)
                                                                  <---------AHL12(1)
                                                                 --------->AHL20(3)
                                                                 --------->AHL25(2)
                                                                 <---------AHL25(2)
                                                                 <---------AHL20(3)
                                                                --------->YAB1
                                                              --------->AHL20(2)
                                                             <---------AHL20(2)
                                                            --------->AHL20(2)
                                                          <---------AHL12(2)
                                                         <--------ATHB1
                                                         --------->ATHB51
                                         <---------AHL20(2) <---------AHL20(2)
                                       <---------AHL20(3)--------->AHL12(1)
                                       <---------AHL12(3)<---------AHL12(1)
                                       --------->AHL20(3)<---------ICU4
                                     <---------RVE1(1)   --------->AHL20(2)
                                     <---------CCA1(1)   --------->AHL25(1)
                                    --------->ARR11(3)   --------->AHL20(3)
                                    <---------AHL20(1)   <---------AHL20(2)
           ---------->DOF2          <---------ARR11(3)   --------->AHL25(2)
      --------------->AGL15  --------->YAB1              <---------AHL25(2)
      ----------->GT1        ----------->GT1             <---------AHL25(3)
      <---------------AGL15 <---------YAB5              --------->AHL25(3)
 --------->YAB1           --------->MYB52(1)            --------->ICU4<---------ICU4
<---------KAN1  ---------->DOF2     <---------RVE1(2)   <---------ATHB51
------->YAB1--------->DOF5.7(1)     --------->AHL20(1)  <---------ATHB12        <---------YAB5 -----
---->DOF2  --------->DOF5.7(1)  ---------->DOF2       --------->YAB1 <---------YAB1 ----------------
 
agaataatactgaaaaaaggaaagaaaactaatggtaaagatatttatagagaactacaataatttaaaataatcattttctactcattttgtttatatc  6854100
                                                             <-----------GT1  --------->AHL20(1)
                                                       --------->AHL12(2)     <---------AHL20(1)
                                                       --------->AHL12(3)     <---------RVE1(2)
                                                       <---------AHL12(3)  --------->AHL20(2)
                                                       --------->AHL25(1)  <---------AHL25(1)
                                                      <---------ARR11(3)   --------->AHL25(1)
                                                      <---------AHL12(1)   <---------AHL25(3)
                                                      --------->AHL12(1)   <---------AHL12(3)
                                                      --------->ARR11(3)   <---------AHL20(2)
                                                      <---------AHL25(2)   --------->AHL12(3)
        <---------YAB5                                --------->AHL20(1)  <---------AHL20(2)
    --------->ARR11(2)                                --------->AHL25(3) <---------AHL12(2)
   --------->DOF5.7(2)                                <---------AHL20(1)--------->AHL12(2)         <
<---------YAB5                          <---------WOX13(2) <---------AHL20(2) --------->ARR11(3) ---
---->YAB1--------->YAB1            ----------->GT1 --------->YAB1     <---------YAB1          <-----
----->WRI1                      <---------RVE1(2) <---------YAB1 ----------->GT1            --------
 
gtaatcgtttactcatagtttagcaaatacaatgtgatttgtgaatttagactatgatatattttaacaagttataatttatatattgactagattagga  6854200
                                                                                                   -
                                                                                                   <
                                                                                                   -
                                                                                                   -
                                                                                                   <
                                                                                                   -
                                                                                                   <
                                                                                                   <
                                                                                                   <
                                                                                                   -
                                                                                                   <
                                                                                                   <
                                                                                                   -
                                                                                                   -
                                                                                                  --
                                                                                                  <-
                                                                                                  --
                                                                                                  <-
                                                                                                  <-
                                                                                                  --
                                                                                                 ---
                                                                                                ----
                                                                                                <---
                                                                                                <---
                                                                                                ----
                                                                                                <---
                                                                                                ----
                                                                                               -----
                                                                                               <----
                                                                                               -----
                                                                                               <----
                                                                                               <----
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                  <---------YAB1               -----
                                                                 --------->RVE1(2)             -----
                                                               --------->ICU4                  <----
                                                               <---------ATHB12                <----
                                                              <---------AHL12(2)         --------->TOE2(3)
                                     --------->AHL20(3)       <---------WOX13(2)         --------->TOE1(3)
                                     <---------AHL20(3)      --------->WOX13(1)       <-----------GT1
                                     --------->AHL12(2)    ------------>CBF        <---------AHL25(3)
                                     <---------AHL12(2) --------->AHL12(1)         <---------AHL12(2)
                                    --------->YAB1      <---------AHL12(1)         <---------ICU4<--
-----------HVH21          <---------AHL20(2)         --------->AHL20(2)           --------->AHL20(2)
------>MYB46(3)     --------->ANAC55(2) --------->GLK1(2) --------->RVE1(2)       <---------AHL12(1)
-ZmHOX2a(1)    <---------GATA12    <---------YAB1----------->GT1--------->YAB1    --------->AHL25(1)
->MYB59        --------->GATA12 ----------->GT1---------->DOF2--------->WOX13(2)  --------->AHL12(1)
 
cccgtcgtccaatacacagatttaagtattttaagttgataataatctagtaaagttaaaatatcaattatcaaacttttgccaaatatttaccttaaaa  6854300
          --------->TOE2(3)
<---------AHL12(3)
<---------AHL20(2)
<---------AHL25(3)
--------->AHL25(1)
<---------AHL25(1)
--------->AHL20(2)
-------->AHL12(1)
---------AHL25(3)
-------->AHL12(3)
-------->AHL20(2)
---------AHL20(1)
-------->AHL20(1)
---------AHL12(1)
---------AHL20(2)
---------AHL12(3)
-------->AHL25(1)
---------AHL25(1)
---------AHL25(2)
-------->AHL25(3)
-------->AHL25(2)
------->AHL12(2)
--------AHL25(2)
------->AHL12(3)
--------AHL12(3)
--------AHL12(2)                                  <---------YAB5
------->AHL25(2)                                  --------->ICU4
------>AHL12(2)                                   <---------YAB1
----->AHL12(3)                                  <---------ANAC58
------AHL12(3)                                  <---------ANAC58
------AHL25(3)                                  <---------ANAC46
----->AHL25(2)                                 ---------->ID1
------AHL12(1)                           --------->KAN1
----->AHL12(1)                           <---------AHL12(3)
---->AHL25(2)                            <---------AHL20(2)
-----AHL25(1)                           --------->AHL20(1)
---->AHL12(3)                           <---------AHL20(1)
-----AHL20(1)                           --------->AHL25(3)
-----AHL12(1)                           --------->AHL25(2)
---->AHL12(1)                           <---------ARR11(3)
---->AHL20(2)                           --------->ARR11(3)            --------->DOF5.7(2)
-----AHL20(2)                           <---------AHL25(2)       --------->O2
---->AHL25(1)                          --------->CCA1(2)         --------->bZIP60(1)
---->AHL25(3)                         <---------ARR11(3)         <---------O2
-----AHL25(2)                 <---------------AtSPL3       *TSS  <---------bZIP60(1)
-----AHL25(3)                 <---------------AtSPL8 <---------YAB1 <---------ANAC46              <-
-------AHL12(2)   --------->RVE1(2)   --------->ARR11(3) <---------ZAT6--------->WRKY12          ---
 
aatttatttgcaacctcgaaaaatccatctaaatatgtacagatatatttgtcgtgattactgttacgacgtcgtttaccagttcgttcttccttcttct  6854400
<- Previous    Next ->

AGI:  At4g11260.1   
Description:  SGT1B (enhanced downy mildew 1b); protein binding. similar to SGT1A (Suppressor of G2 (Two) 1A) [Arabidopsis thaliana] (TAIR:AT4G23570.2); similar to SGT1A (Suppressor of G2 (Two) 1A), protein binding [Arabidopsis thaliana] (TAIR:AT4G23570.1); similar to SGT1-like protein [Brassica oleracea] (GB:CAF06580.1); contains InterPro domain SGS (InterPro:IPR007699); contains InterPro domain HSP20-like chaperone (InterPro:IPR008978); contains InterPro domain Tetratricopeptide-like helical; (InterPro:IPR011990); contains InterPro domain CS (InterPro:IPR007052); contains InterPro domain Tetratricopeptide TPR-1 (InterPro:IPR001440); contains InterPro dom
Range:  from: 6851273    to: 6853856    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At4g11270.1   
Description:  transducin family protein / WD-40 repeat family protein. similar to unnamed protein product [Vitis vinifera] (GB:CAO65901.1); contains InterPro domain WD40 repeat-like (InterPro:IPR011046); contains InterPro domain WD40/YVTN repeat-like (InterPro:IPR015943); contains InterPro domain WD40 repeat (InterPro:IPR001680)
Range:  from: 6854360    to: 6859660    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version