AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
     --------->ZAT6
 <---------ANAC58           --------->DOF5.7(1)                                           --------->ANAC58
 <---------ANAC58         ---------->DOF2        --------->ZAT6   --------->ANAC46        --------->ANAC58
---------ARR11(3)     <-----------GT1  <-----------GT1   <---------AHL12(2)      <-----------GT1 ---
 
aatttcttactctaaacacctagttttacaaaagaggtctagtaacctgttaacactaaaaaaaaacatccacaactctatgtttttcttctcaagtcaa  5603800
                                                       <---------ICU4
                                                       --------->YAB1
                                                      --------->ICU4
                                                      <---------YAB5
                                                     --------->AHL12(2)
                                                     <---------WOX13(2)
                                                     <---------AHL12(2)
                                                     --------->WOX13(2)
                                                   <---------AHL12(1)
                                                   <---------AHL12(3)
                                                   --------->AHL12(1)
                                                   <---------AHL25(3)
                                                   --------->AHL12(3)
                                                   --------->AHL20(2)
                                                   <---------AHL20(2)
                                                   --------->AHL25(3)
                                                   --------->AHL25(1)
                                                   <---------AHL25(1)
                                                  <---------AHL25(2)
                                                  <---------AHL20(1)
                                                  --------->AHL20(1)
                                                  <---------AHL25(3)
                                                  --------->AHL20(2)
                                                  --------->AHL25(1)
                                                  <---------AHL25(1)
                                                  --------->AHL25(3)
                                                  <---------AHL12(3)
                                                  --------->AHL12(3)
                                                  --------->AHL25(2)
                                                  <---------AHL20(2)
                                                 --------->AHL12(2)
                                               <---------AHL12(1)
                                               --------->AHL12(1)
                                               <---------AHL12(3)                                 --
                                              <---------AHL12(1)                                 ---
                                              --------->AHL12(1)                               <----
                                              --------->AHL25(3)                               -----
                                          --------->ANAC58                                  --------
                                          --------->ANAC46                              <-----------
                                  <---------RVE1(2)--------->AHL25(2)            <---------WOX13(2)
                     <---------YAB1--------->KAN1<---------AHL12(2)              --------->WOX13(2)
          ----------->GT1  <---------YAB1 --------->ANAC58                       <------------CBF---
------>KAN1  <-----------GT1      <---------YAB5<---------AHL12(2)        <------ZmHOX2a(1)---------
 
acactcttgaacattgttactactatgcttcttattagacattccaagaaaaatttaattatcacttgtatagcataggaatcaaattgagcattgacaa  5603900
  --------->ALFIN1                                                                               ---
-------->DOF2                                                                                    ---
------>AHL20(2)                                                                               ------
-----WOX13(2)                                                                                 <-----
---->WOX13(2)                                               --------------->AtSPL8            ------
---->CBF            --------->TOE1(2)   --------->MYB52(1) <----------DOF2 --------->ANAC55(2)<-----
-CBF <---------ANAC46           ----------->GT1      <-----------GT1      --------->RVE1(2)<--------
------>YAB1 <----------DOF2   ---------->DOF2    <----------DOF2------------>CBF          <---------TOE1(3)
>YAB1<---------REM1(1)    --------->At4g35610<---------GLK1(2) <-----------GT1            <---------TOE2(3)
 
ttaaagtgttgtagactttaaaacctagtagccgaaagaaaaaaaacagatgctttaaaccactttgtacaattccatatgtaatagactattaacgtat  5604000
                                                      --------->AHL12(1)
                   --------->YAB1                     <---------AHL12(1)
               --------->RVE1(2)                      --------->KAN4(1)
               <---------ARR11(3)              --------->STY1(2)
               --------->ARR11(3)          <------NtERF2
              --------->RVE1(1)           <---------RAP2.6(3)                <---------MYB52(1)
          --------->AHL20(2)              ------>NtERF2--------->KAN4(2)   --------->YAB5
          --------->AHL12(3)             --------->RAP2.3(2)              <---------YAB5
          <---------AHL12(3)             --------->ANAC46        ----------->TBP
          --------->AHL20(3)             --------->RAP2.3(3)   --------------->AGL15
          <---------AHL20(3)             --------->DEAR3(1)    <---------------AGL15
          --------->AHL25(2)--------->ANAC46  --------->ANAC58<---------------AGL15
------>ANAC46 --------->CCA1(1)          --------->RAP2.6(2)  --------------->AGL15
------>ZAT6  <---------AHL25(2)         --------->ERF1--------->KAN1 <---------TOE2(3)
--->ARR11(2) --------->AHL25(2)       --------->ANAC46<---------KAN4(1)<------ZmHOX2a(1)
----ARR11(2)--------->AHL12(3)       --------->DOF5.7(1)      ----------------->AGL3         -------
--->ARR14(2)--------->AHL20(3)      ---------->DOF2 <---------GLK1(2)--------->ANAC46    --------->TOE2(3)
----ARR14(2)<---------AHL20(3)---------->DOF2 --------->ANAC58<-----------------AGL3     <---------MYB59
-ANAC46  --------->YAB1--------->RVE1(2)--------->RAP2.3(1)   <-----------------AGL2     --------->TOE1(3)
 
acactacttgaataaaaatatctcataatccacaaaagtaaaagccgccaagctagattattctgcctatataaggaatcgttacgaagaaacctaaatt  5604100
          --------->TOE2(3)                                    <---------AHL20(2)
          --------->YAB1                                       <---------AHL20(3)
          --------->TOE1(3)                                   --------->AHL20(2)
   <-----------ARR10                                          --------->AHL25(3)
   --------->RVE1(2)                                    <----------DOF2 --------->GLK1(1)
  <---------CCA1(2)                                    <---------DOF5.7(1)           ------>ZmHOX2a(1)
--------->YAB1                                 <-------TEIL--------->YAB1    <<<<<<<<<TBF1
-->WOX13(2)           --------->KAN1  ---------->DOF2 ------>ZmHOX2a(1) <---------GLK1(1)       <---
 
cactcatatctaaccataaccaaaaacattctcttagagagcaaagaaaatgcattcctctttgataaaattgggatttcttcttctccttcttcaggtc  5604200
                                                         <---------RVE1(2)
                                                     <----------DOF2
                                                 --------->ANAC58                               ----
                                                 --------->ANAC58                               <---
                                              <------NtERF2                                 ========
                                             --------->ANAC58                              ---------
                           <---------DOF5.7(1)--------->LBD16                              <--------
                          <----------DOF2   <---------LBD16                              -----------
              <---------MYB52(2)          --------->ARR14(2)                         <---------At4g35610
             --------->WOX13(2)          --------->KAN1 --------->YAB1        <---------YAB1<------ZmHOX2a(2)
     --------->KAN1       <---------DOF5.7(1)--------->ANAC58           <---------YAB1<----------CDC5
------YAB1   <---------WOX13(2)<---------YAB1--------->ANAC46     --------->MYB46(3) --------->At4g35610
 
tcattgtctcatgctcaactaagcccttccttttacgataaaacatgtccgcaagtctttgatattgtaaccaataccattgtcaatgcgctgagatcag  5604300
                                                                              <-------TEIL
                                                                           --------->KAN1
                                                                          --------->ARR11(3)
                                                                          <---------ARR11(3)
                                                                          <---------AHL20(1)
                                                                     <-------TEIL
                                                                   <---------ARR14(2)
 --------->ANAC58                                                  --------->ARR14(2)              <
 --------->ANAC58                                                  --------->ARR11(2)       <-------
----->ARR14(2)             <---------YAB5                          <---------GATA12         --------
------ARR14(2)      ------>ZmHOX2a(1)                              --------->GATA12        <--------
===========================HOX2a_HOX2a            <---------TOE2(3)<---------ARR11(2)      ---------
>GATA12      --------->ANAC46              <----------DOF2         <---------GLK1(2)  <---------ARR11(3)
-GATA12      --------->ANAC58       --------->ANAC46              --------->KAN1    ------->TEIL  <-
>ARR10       --------->ANAC58  --------->ARR11(2) <---------WOX13(2)--------->ARR14(1)--------->AHL20(1)
 
accctcgcatcgctgcaagcatccttcgtcttcatttccacgactgctttgttaatgtaagataccaccagattcgatatattcatgtatatattaagta  5604400
                                                                                                   <
                                                                                                   <
                                                                                                   <
                                                                                                   <
                                                                                                   <
                                                                                                  <x
                                                                                                  <x
                                                                                                  xx
                                                                                                  <x
                                                                                                  <x
                                                                                                  <x
                                                                                                  <x
                                                                                                 <xx
                                                                                                 <xx
                                                                                                 <xx
                                                                                                 xxx
                                                                                                 <xx
                                                                                                 <xx
                                                                                                 <xx
                                                                                                 <xx
                                                                                                 <xx
                                                                                                 <xx
                                                                                                 <xx
                                                                                                <xxx
                                                                                                <xxx
                                                                                                <xxx
                                                                                                <xxx
                                                                                                <xxx
                                                                                                ----
                                                                                                <xxx
                                                                                                <xxx
                                                                                               <xxxx
                                                                                               <xxxx
                                                                                               <xxxx
                                                                                               <xxxx
                                                                                               <xxxx
                                                                                               <xxxx
                                                                                               <xxxx
                                                                                               <xxxx
                                                                                               <xxxx
                                                                                               <xxxx
                                                                                               <xxxx
                                                                                               <xxxx
                                                                                               <xxxx
                                                                                              <xxxxx
                                                                                              <xxxxx
                                                                                           <xxxxxxxx
                                                                                           ---------
                                                                                         xxxxxxxxxxx
                                                                                         <---------ANAC58
                                                                                         <---------ANAC58
                                                                                        <xxxxxxxxxxx
                                                                                     <xxxxxxxxxxxxxx
                                                                                   xxxxxxxxxxxxxxxx>smallRNA(i)
                                                                                   <xxxxxxxxxxxxxxxx
                                                                                   <xxxxxxxxxxxxxxxx
                                                                                   <xxxxxxxxxxxxxxxx
                                                                                   xxxxxxxxxxxxxxxxx
                                                                                  xxxxxxxxxxxxxxxxxx
                                                                                  <xxxxxxxxxxxxxxxxx
                                                                                  xxxxxxxxxxxxxxxx>smallRNA(s)
                                                                                  <xxxxxxxxxxxxxxxxx
                                                                                  <xxxxxxxxxxxxxxxxx
                                                                                <xxxxxxxxxxxxxxxxxxx
                                                                               xxxxxxxxxxxxxxxx>smallRNA(s)
                                                                               <xxxxxxxxxxxxxxxxsmallRNA(s)
                                                                              xxxxxxxxxxxxxxxx>smallRNA(i)
                                                                              xxxxxxxxxxxxxxxx>smallRNA(s)
                                                                             xxxxxxxxxxxxxxxx>smallRNA(i)
                                                                             xxxxxxxxxxxxxxxx>smallRNA(s)
                                                                            xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                                                                           xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                                                          xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                                                          xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
                                                                          xxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                                                                          xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                                                                         <xxxxxxxxxxxxxxxxsmallRNA(s)
                                                                         xxxxxxxxxxxxxxxx>smallRNA(s)
                                                                         <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                                                        <xxxxxxxxxxxxxxxxsmallRNA(s)
                                                                        xxxxxxxxxxxxxxxx>smallRNA(s)
                                                                       <xxxxxxxxxxxxxxxxxsmallRNA(si3)
                                                                       <xxxxxxxxxxxxxxxxsmallRNA(i)<
                                                                      xxxxxxxxxxxxxxxx>smallRNA(s)<x
                                                                      <xxxxxxxxxxxxxxxxsmallRNA(i)<x
                                                                     xxxxxxxxxxxxxxxx>smallRNA(s)<xx
                                                                    xxxxxxxxxxxxxxxx>smallRNA(i)<xxx
                                                                  <xxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
                                                                  xxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                                                                  <xxxxxxxxxxxxxxxxxsmallRNA(se3)<xx
                                                                  <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
                                                                  <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                                                  <xxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                                                  xxxxxxxxxxxxxxxx>smallRNA(s)xxxxxx
                                                                  <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                                                                <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
                                                                <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                                                           <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)<xxx
                                                        xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3) <xxxxx
                                                       xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)xxxxxxxx
                                                       xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)xxxxxxxxx
                                                     <---------YAB5xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                                   --------->YAB1 <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                                                  <---------AHL20(2)xxxxxxxxxxxxxxxx>smallRNA(s)<xxx
                                                xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)xxxxxxxxxxxxxxx
                                                <---------KAN1  xxxxxxxxxxxxxxxx>smallRNA(i)xxxxxxxx
                                               --------->ARR11(2)xxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                               <---------ARR11(2)<xxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
                                               <---------ARR14(2)xxxxxxxxxxxxxxxx>smallRNA(s)<xxxxxx
        <----------DOF2                     <---------ANAC46    ---------->DOF2xxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
----------DOF2              --------->DAG2  <---------TOE2(3)  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
--ANAC55(2)                --------->DOF5.7(1) --------->ARR14(2)<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
->ANAC55(2)                ---------->DOF2 <---------LBD16<xxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)<xxxxx
-------AtSPL8           ------>ZmHOX2a(1) --------->MYB52(1) xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)<x
------>AtSPL8          --------->TOE2(3)<---------DAG2--------->YAB1xxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
--------DOF5.7(1)  --------->KAN1       <----------DOF2xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)xxxxxxxx
 
ctcttttggttctttgatggttttatcctaaaaagtgagaatgctttacggatataatcatatatatgaaagttggccaactctctccatttgggtgaca  5604500
         xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
        --------->ANAC58
       <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
       <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
       <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
       <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
      xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
      xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
      xxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
     xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
    --------->ANAC58
    --------->ANAC58
    <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
    --------->ANAC46
  <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
  <xxxxxxxxxxxxxxxxsmallRNA(i)
 <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
<xxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
xxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
xxxxxxxxxxxxxxxxxxxxsmallRNA(l2)
xxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
xxxxxxxxxxxxxxxxxxx>smallRNA(se3)
xxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
xxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
xxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
xxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
xxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
xxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
xxxxxxxxxxxxxxsmallRNA(i)
xxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
xxxxxxxxxxxxxxxxxxxxsmallRNA(l2)
xxxxxxxxxxxxxxsmallRNA(s)
xxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
xxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
xxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)
xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
xxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
xxxxxxxxxxxxxxxxxxxsmallRNA(i2)
xxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
xxxxxxxxxxxxxxxxxxxxsmallRNA(s2)
xxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
xxxxxxxxxxxxxxxxxxxsmallRNA(si3)
----->bZIP60(2)
xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
xxxxxxxxxxxxxxxxxxxxsmallRNA(l2)
xxxxxxxxxxxxxxxxxxsmallRNA(si3)
xxxxxxxxxxxxxxxxxxxsmallRNA(i2)
xxxxxxxxxxxxxxxxxxxsmallRNA(si3)
xxxxxxxxxxxxxxxxxxsmallRNA(l2)
xxxxxxxxxxxxxxxsmallRNA(i2)
xxxxxxxxxxxxxxxxxsmallRNA(i2)
xxxxxxxxxxxxxxxxxxsmallRNA(i2)
xxxxxxxxxxxxxxxxxxxsmallRNA(l2)
xxxxxxxxxxxxxxxxxxsmallRNA(s2)
xxxxxxxxxxxxxxxxxxxsmallRNA(se3)
xxxxxxxxxxxxxxxxxxsmallRNA(le3)
xxxxxxxxxxxxxxxxxxxsmallRNA(le3)
xxxxxxxxxxxxxxxxxxxsmallRNA(s2)                 <---------AHL12(3)
xxxxxxxxxxxsmallRNA(fl3)                        --------->AHL20(2)
xxxxxxxxxxxxxxxxxxxsmallRNA(l2)                 <---------AHL20(2)
xxxxxxxxxxxxxsmallRNA(si3)                      --------->AHL20(1)
-->HVH21--------->ANAC58                        <---------AHL25(1)
xxxxxxxxxxx>smallRNA(le3)                       <---------AHL25(3)
xxxxxxxxxxxxsmallRNA(l2)                        --------->AHL12(1)
xxxxxxxxsmallRNA(i2)                            --------->AHL25(1)
xxxxxxsmallRNA(fl3)                             <---------AHL12(1)
xxxxxxxsmallRNA(le3)                            --------->AHL25(3)
xxxxxxxsmallRNA(si3)                            --------->AHL25(2)
xxxxxx>smallRNA(si3)                            <---------AHL25(2)
xxxxx>smallRNA(i2)                             --------->AHL20(2)
xxxxxxsmallRNA(fl3)                            --------->AHL12(3)
xxxxxxsmallRNA(le3) ------->MYC3               --------->AHL25(1)
xxxxxsmallRNA(si3)  <-------MYC3               <---------AHL12(3)
xxsmallRNA(le3)    --------->O2                --------->AHL25(3)
---------ICU4      <---------O2                <---------AHL25(2)
xxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)             --------->AHL25(2)
xxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)      <---------YAB1
xxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)    --------->AHL20(2)
xxxxxxxxxxxxxxxxxxxxsmallRNA(se3)     --------->YAB1
xxxxxxxxxxxxxxxxxxxxxsmallRNA(s2)    <---------YAB1
xxxxxxxxxx>smallRNA(s)               <---------YAB5
xxxxxxxxxxxxxxxxxxxsmallRNA(l2)     --------->WOX13(2)
xxxxxxxxxxxxxxxxxsmallRNA(i2)       <---------AHL12(2)                        ---------->DOF2
xxxxxxxxxxxxxxx>smallRNA(si3)       <---------WOX13(2)               <------ZmHOX2a(1)
xxxxxxxxxxx>smallRNA(fl3)         --------->AHL25(3)           --------->WOX13(2)
xxxxxxxxxxxxxxxxxxxxsmallRNA(le3) <---------AHL20(2)           <---------WOX13(2)
xxxxxxxx>smallRNA(i2)             <---------AHL25(3)         <---------------AGL15              ----
xxxxxxxxxx>smallRNA(se3)          --------->AHL25(1)         --------------->AGL15          --------
xxxxxxxxxxxxxxxxxsmallRNA(i2)     --------->AHL20(2)<---------------AtSPL8  --------->YAB1<---------ANAC46
xxxxxxxxxxxxxxxxxxsmallRNA(i2)  --------->TOE2(3)   <---------ICU4  ----------->GT1    <-----------RAV1(1)
xxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)--------->YAB1   --------------->AtSPL8--------->RVE1(2) <-------
xxxxxxxxxx>smallRNA(fl3)     <-----------GT1   <---------AHL25(1)  <---------TOE2(3)<----------DOF2
 
catcatcacacaagaaaatgacatgtgtcattttacattaattataaaaaaaaaattagtacaactaattgaggaaaaatcaaaagtcttttgttgtgta  5604600
                                                                                                  <-
                                                                                                  --
                                                                                                  <-
                                                                                                 <--
                                                                                                 <--
                                                                                                 ---
                                                                                                 <--
                                                                                                 ---
                                                                                                 ---
                                                                                                 ---
                                                                                                 <--
                                                                                                 <--
                                                                                                ----
                                                                                                <---
                                                                                                <---
                                                                                                <---
                                                    --------->AHL12(1)                          ----
                                                    <---------AHL12(1)                          ----
                                                   <---------AHL12(2)                           ----
                                                 --------->AHL20(2)                             <---
                                                 <---------AHL25(3)                             ----
                                                --------->AHL20(2)                              ----
                                              <---------AHL12(2)                                <---
                                             --------->AHL20(2)                                 <---
                                            <---------ATHB12     <<<<<<<<<EIN3                 -----
                                       --------->ANAC58 <---------ICU4            --------->KAN1<---
                                       --------->ANAC46 --------->YAB5--------->DAG2           <----
                               <---------HSFB2a(2)<---------AHL12(2)  --------------->AtSPL8   -----
----->KAN1                     --------->HSFB2a(2)--------->AHL12(2) ---------->DOF2          ------
--->GT1                  ------->TEIL  --------->ANAC58 --------->YAB1<---------------AtSPL8<-------
--ANAC46                 <---------AHL12(2) --------->AHL20(2)  ----------->GT1<----------DOF2<-----
 
aattctctattaatctcactcttaaatgaattttctaaaaacactcaataaataaaaaatcataacaatgtataaagtactactttcattctattctaat  5604700
<- Previous    Next ->

AGI:  At4g08780.1   
Description:  peroxidase, putative. Identical to Peroxidase 38 precursor (PER38) [Arabidopsis Thaliana] (GB:Q9LDA4); similar to peroxidase, putative [Arabidopsis thaliana] (TAIR:AT4G08770.1); similar to Peroxidase C2 precursor (GB:P17179); contains InterPro domain Plant peroxidase; (InterPro:IPR000823); contains InterPro domain Haem peroxidase; (InterPro:IPR010255); contains InterPro domain Haem peroxidase, plant/fungal/bacterial; (InterPro:IPR002016)
Range:  from: 5604150    to: 5608199    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version