AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                               --------->KAN1
                                                                              <---------AHL12(2)
                                                                              <---------YAB1
                                                                             --------->AHL20(3)
                                                                             --------->AHL12(2)
                                                                             <---------AHL20(3)
                                                                             <---------AHL25(2)
                                                                             --------->AHL25(2)
                                                                            <--------HAHB4
                                                                            <---------ICU4
                                                                           --------->ICU4
                                                                           <---------YAB1
                                                                   --------->TGA2(2)
                                                                 --------->ANAC46
                                                                 --------->ANAC58
                                                                 --------->ANAC55(1)
                                      ------>ZmHOX2a(2)          --------->ANAC58
                 <-------GAMYB       --------->GLK1(1)           <---------ANAC55(2)               -
                --------->MYB111(2)  <---------GLK1(1)           --------->ANAC55(2)         <------
     <-------GAMYB                  <---------GATA12  --------->ANAC46   --------->YAB1      -------
     <---------At4g35610            <---------ARR11(3)--------->ANAC58   --------->YAB5      <------
    --------->ALFIN1  <---------RVE1(2)   ------>ZmHOX2a(1)     --------->SPL7(1)            -------
----MYC3        <---------MYB46(3)  --------->ARR11(3)--------->ANAC58<---------CCA1(2)      <------
--->MYC3    <---------TOE2(3)       --------->GATA12<-----------RAV1(2) <---------YAB1   <----------
-----KAN1   <---------TOE1(3)   --------->YAB1  <---------ARR11(3)<-----------HVH21 <---------YAB1 <
 
atggagggagttgctaaggttgttagagatgtctaagatgatctccttcaagttctcaggcaattcatacgtcatatcattattattctcattgtcactt  1012600
                   <---------ARR11(2)
                   <---------ARR14(2)                                                     ------>ZmHOX2a(2)
                   ------->TEIL                                                          <------ZmHOX2a(2)
                   --------->ARR11(2)                                                   --------->ARR11(3)
                   --------->ARR14(2)                                                   <---------ARR14(2)
                   --------->ARR11(3)                                                   --------->GATA12
                   <-----------ARR10                                                    --------->RVE1(2)
                --------->ANAC58                                                        --------->ARR11(2)
                --------->O2                   ----------->RAV1(1)                      <---------GATA12
                <---------O2                 --------->At4g35610                        <---------ARR11(2)
                --------->TGA1a             --------->ANAC58                            --------->ARR14(2)
                --------->ANAC46            --------->ANAC58                            <---------ARR11(3)
                --------->ANAC58        <------MYB46(1)                                <---------KAN1
                --------->ANAC55(2)     <------MYB83                              <------ZmHOX2a(2)
-------->HSFB2a(2) <---------ARR11(1)   <---------MYB46(3)                       --------->RVE1(2)
---O2      --------->ANAC58            <---------DEAR3(1)                        --------->GATA12
-->ANAC55(2)    --------->ANAC55(1) <---------ANAC58         <-------GAMYB       <---------GATA12 <-
---TGA1a   --------->ANAC58         <---------bZIP60(2)     <---------ANAC46     --------->ARR11(3)
-->O2--------->MYB46(3)          ----------->HVH21       <---------bZIP60(1) <------ZmHOX2a(1)    <-
---ANAC55(2)    <---------ANAC55(2) <---------ANAC46     --------->bZIP60(1) ====================HOX2a_HOX2a
-HVH21     --------->ANAC46      ----------->TGA1--------->KAN1--------->WRKY12  <---------ARR11(3)
---------HSFB2a(2)<---------CCA1(2) <---------ANAC58   <---------TGA2(2)     ===================HOX2a_HOX2a
 
gtcgagaaaccatcaagacacgtatcttggtatgtcatgacgttggtgagcaacatgctgatgtcgttgaactcaagagaggaagatcgaagatcggaga  1012700
                                                                          <------MYB83
                                                              --------->YAB1
                                                             <-------TEIL <------MYB46(1)
                 <---------AtMYB61                         --------->TOE2(3)
           <---------DEAR3(1)                        --------->ANAC58    --------->MYB59
         <-----------HVH21                           --------->ANAC58  <<<<<<<<<MYB98
  --------->ARR14(2)  <---------YAB5                 <---------ANAC55(2) <---------AtMYB61
  --------->ARR11(2) <-----------HVH21               --------->ANAC46  <---------MYB52(1)        <--
  <---------ARR11(2)<---------bZIP60(1)             <---------------------WRI1       --------->DOF5.7(1)
  <---------ARR14(2)--------->bZIP60(1)             --------->ZAT18   <-------GAMYB--------->DOF5.7(1)
--------ZAT14 <---------RVE1(2)                    <---------KAN1    <------MYB46(1)--------->DOF5.7(1)
--------LBD16<------NtERF2         --------->LBD16--------->ARR11(2) <------MYB83  ---------->DOF2 <
 
ctgcggtttcgaggtcggagatggtgtcatcgagtagcccgagacagtcttcgaatgcgcaacgttcatagtgggttaggtttggaaaaagacgggtttg  1012800
                                           <------MYB46(1)
                                           <------MYB83
                                          --------->MYB59       --------->ZAT2
                                        <---------MYB52(1) --------->YAB5
                                       <-------GAMYB  <------NtERF2                    <-------GAMYB
                              <----------DOF2         --------->LBD16          <---------AtMYB61
   <------NtERF2             --------->TOE1(3)      <---------LBD16       <------MYB46(1)
 <---------DEAR3(1)          --------->TOE2(3)      --------->ZAT18<---------LBD16   <---------ANAC46
-------AtMYB61 <------ZmHOX2a(1)      <---------MYB46(3)  <---------YAB1  <------MYB83----------->GT1
-----------HVH21          <-----------GT1 <---------AtMYB61--------->YAB1<---------AtMYB61
 
gaggtcggagaagttggaggaagcgagattaacctttaagatggttaggtttaagtccgcgatgataagctcggggatggttttggtttcggttaaacgc  1012900
                       <---------MYB46(3)    <---------RVE1(2)        ----------->HVH21
                       --------->ATHB12      <---------ARR11(2) --------->YAB5        --------->AHL20(3)
                <---------YAB1          ------->GAMYB     <------ZmHOX2a(1)           <---------AHL25(2)
            <---------ANAC46 <---------At4g35610         <----------ID1          ----------->GT1
         --------->ALFIN1<---------WOX13(1)<---------MYB46(3)  --------->DOF5.7(1)    <---------AHL20(3)
         <---------AtMYB61   --------->At4g35610    --------->YAB5    <---------ZAT6  --------->AHL25(2)
   <---------ANAC46   <---------YAB1 --------->MYB52(1) --------->MYB59        <---------WOX13(2)<--
 
tgggttttgtgagtggtgtatgatggtgattgagatgaaacaacggtggataagaagattaggaaaaagattagtgacagtaagttgaaaataatgtgtt  1013000
                          <---------YAB1
                          <---------YAB5
                         <-----------GT1
                        --------->YAB1
                        <-----------GT1
                      --------->AHL12(2)
                      <---------AHL12(2)
                     --------->AHL12(2)                                    --------->MYB52(1)
                    --------->AHL12(1)                       <---------AHL25(2)
                    <---------AHL12(1)                       <---------AHL12(2)
                    --------->AHL20(2)           <---------YAB5      <----------ID1
                   <---------YAB1            <---------ZAT14 --------->AHL25(2)
                 --------->YAB5           >>>>>>>>>ARR2      --------->AHL12(2)
          --------->WOX13(2)              <------------CBF   <---------AHL12(1)
          <---------WOX13(2)            <---------YAB1       <---------AHL20(3)
      --------------->AGL15             <---------TOE1(3)    --------->AHL12(1)
      <---------------AGL15             <---------TOE2(3)    --------->AHL20(3)
     <-----------------AGL2         <----------DOF2         <---------AHL12(1)             ---------
     <-----------------AGL3--------->YAB1 >>>>>>>>>ARR1     --------->AHL12(1)            ----------
-------AtMYB61  <---------YAB1<---------DOF5.7(1)<---------ZAT6    ---------->DOF2 ----------->GT1
 
ttggtttttctctaattggatgattatttatcattttttctttaagattgtagtgatagtagaaaattttaaaagacaaaactgaaatgtaacaaaagtg  1013100
                                                                       ---------->DOF2
                                     <---------AHL25(1)                --------->DOF5.7(1)
                                     <---------AHL20(2)              <---------AHL25(3)
                                     --------->AHL20(2)             --------->AHL20(2)
                                     --------->AHL12(3)           <---------WOX13(2)
                           ----------->GT1                        <---------AHL12(2)
                          --------->DAG2                         <---------AHL20(2)
               <------ZmHOX2a(2)     ----------->TBP             <---------AHL25(3)                -
              --------->GATA12 ------------>CBF                 --------->AHL20(2)                 <
<------------CBF    ------->GAMYB    <---------AHL12(3)         --------->AHL25(3)                 -
<---------GLK1(2) --------->At4g35610--------->AHL25(1)     <---------ARR11(3)         <---------LBD16
>DAG2         <---------GATA12<-----------GT1            ----------->RAV1(1)  ----------->GT1      <
>DOF2<---------MYB46(3)  ---------->DOF2                --------->ANAC46 --------->DOF5.7(1)      <-
 
aaagattgtggttcttagatcaactcccaaaagtaacaatataaatacgaagaacatatacaacatattaaataaaaagagaagataaactggggagaag  1013200
                                                                                                 ---
                                                                                                 <--
                                                                                                 ---
                                                                                                 ---
                                                                                                 <--
                                                                                                 <--
                                                                                                 <--
                                                                                                 <--
                                                <---------WOX13(2)                               ---
                                                --------->WOX13(2)                               <--
                                               <---------AHL20(2)                                ---
                                              --------->AHL20(2)                                 ---
                                              <---------AHL25(1)                                 ---
                                              <---------AHL20(2)                                 <--
                                            <---------AHL12(2)                                   ---
                                            --------->AHL12(2)                                  ----
                                           <---------AHL25(3)                                   ----
                                          <---------AHL20(3)                                   <----
                                          --------->AHL25(2)                    <---------AHL20(1)
                                          <---------AHL25(1)                    --------->AHL20(3)
                                          <---------AHL25(2)                    <---------AHL20(3)
                                          --------->AHL25(3)                    --------->AHL25(1)
                                          --------->AHL25(1)                    --------->AHL25(2)
                                          --------->AHL12(1)                    <---------AHL25(2) -
                                          <---------AHL12(1)                    <---------AHL20(2) <
                                          <---------AHL25(3)                    --------->AHL20(2) <
                                          --------->AHL20(2)                    --------->AHL20(1)<-
                                          --------->AHL20(1)                   --------->AHL20(2)<--
                                          <---------AHL20(1)                --------->YAB5     -----
                                          <---------AHL20(2)             <------------CBF    -------
                                          --------->AHL20(3)      <---------AHL20(2)         <------
                                         --------->AHL12(2)       <---------AHL25(3)       ---------
                                        <---------AHL12(2)       <---------AHL25(3)     <---------AHL20(2)
                                        <---------WOX13(2)       <---------AHL20(1)   <---------YAB1
                                        --------->AHL12(2)       <---------AHL20(3)  --------->AHL25(2)
                                        --------->WOX13(2)       --------->AHL20(3)  <---------AHL20(3)
                                       <---------AHL25(3)        <---------AHL20(2)  --------->AHL20(3)
                                       <---------AHL20(3)        --------->AHL20(2)  <---------AHL20(2)
                                       <---------AHL20(2)        --------->AHL25(1)  <---------AHL25(2)
                                       --------->AHL20(2)        --------->AHL25(2)<---------AHL20(2)
                                       --------->AHL20(3)        --------->AHL20(1)--------->AHL20(3)
   <---------YAB1                     --------->AHL25(1)         --------->AHL12(1)<---------AHL20(3)
-------->AHL25(2)                     <---------AHL20(2)         <---------AHL12(1)<---------AHL25(2)
---------AHL25(2)                     --------->AHL25(3)         <---------AHL25(2)<---------AHL12(3)
-------->AHL20(3)           <---------RVE1(2) --------->AHL25(3) --------->AHL25(3)--------->AHL25(3)
---------AHL20(3)      <----------DOF2--------->AHL20(2)         <---------AHL25(1)<---------AHL25(1)
--------KAN1      --------->KAN1   <---------ZAT6               --------->AHL12(2) --------->AHL12(3)
 
aatattatgttagtcaaactaaaattctttagattatagtattaatttattaattcaacttaaactaatttattcaaattgattatattattttaagtaa  1013300
         --------->WOX13(2)
         <---------WOX13(2)
       <---------AHL20(3)
       --------->AHL20(3)
       --------->AHL25(1)
       --------->AHL12(3)
       <---------AHL12(3)
       --------->AHL20(2)
       <---------AHL20(2)
       --------->AHL25(2)
       <---------AHL25(3)
      --------->AHL12(3)
      <---------AHL12(3)
      --------->AHL25(1)
      <---------AHL25(1)
      <---------AHL20(2)
      --------->AHL20(1)
      <---------AHL20(1)
      --------->AHL20(2)
      <---------AHL25(2)
      <---------AHL25(3)
      --------->AHL25(3)
      --------->AHL25(2)
   <---------WOX13(2)
   <---------AHL12(2)
  <---------AHL25(3)
  <---------AHL20(2)                                                                               <
 --------->AHL20(3)                                                                               <-
 <---------AHL12(3)                                                                              ---
 <---------AHL20(2)                                                                              <--
 --------->AHL12(3)                                                                             <---
 --------->AHL20(2)                                                                             <---
 --------->AHL25(1)                                                                             ----
 <---------AHL20(3)                                                                             ----
 --------->AHL12(1)                                                                             ----
 <---------AHL25(1)                                                                             <---
 <---------AHL12(1)                                                                             ----
 <---------AHL25(3)                                                                             <---
 --------->AHL25(3)                                                                             ----
------>AHL12(3)                                                                                 ----
-------AHL20(2)                                                                                 <---
------>AHL20(1)                                                                                <----
------>AHL20(2)                                                                                -----
-------AHL12(3)                                                                               <-----
-------AHL20(1)                                                                              <------
-------AHL25(3)                                                                              -------
-------AHL25(2)                                                                             --------
------>AHL20(3)                                                                             <-------
-------AHL12(1)                                                                             --------
------>AHL12(1)                                                                             --------
------>AHL25(3)              --------->TOE2(3)                                              --------
------>AHL25(2)             --------->ANAC58                                                --------
-------AHL20(3)             --------->ANAC58                                                <-------
------>AHL25(1)             <---------ANAC55(2)                                             <-------
----->AHL12(2)              --------->ANAC55(2)                                             <-------
----->AHL25(3)              --------->ANAC46                                            --------->AHL25(3)
-----WOX13(2)               ----------->GT1                                             --------->AHL25(2)
-------->WOX13(2)      ------>ZmHOX2a(1)                                                --------->AHL20(2)
---------AHL12(2)  <-----------GT1                                    <-------TEIL      <---------AHL25(1)
---------WOX13(2)--------->HSFC1(2)--------->AHL20(2)          <---------KAN1           --------->AHL20(1)
--------AHL25(3) <---------HSFC1(2)<---------AHL25(2)         --------->ARR14(2)        <---------AHL20(1)
-------AHL25(1)  --------->HSFB2a(1)    <-------TEIL          <---------ARR11(2)        <---------AHL20(2)
---->WOX13(2)    <---------HSFB2a(1)--------->DOF5.7(1)       --------->ARR11(2)        --------->AHL25(1)
-->AHL20(2)      <---------KAN1    --------->AHL25(2)       --------->LBD16             <---------AHL20(3)
---AHL20(2)     <---------AHL12(2) <---------AHL12(3)   <-----------GT1                 --------->AHL20(3)
>ANAC55(2)   <---------TOE2(3)     <---------AHL25(1)<---------AHL12(2)         --------->At4g35610-
 
ttaattaaataaaattaagaattttcctactacgtaaaaaaaatgcatagactacaaattttccgaatacatatacatatagtagcttcaataaaataaa  1013400
   --------->WOX13(2)
   <---------WOX13(2)
  <---------AHL12(2)
 --------->AHL25(2)
 --------->AHL25(3)
 <---------AHL12(1)
 <---------AHL25(3)
 <---------AHL25(1)
 --------->AHL12(1)
 <---------AHL25(2)
 <---------AHL20(2)
 --------->AHL20(2)
 --------->AHL25(1)
 --------->AHL20(1)
 <---------AHL20(1)
 <---------AHL12(3)
 <---------AHL20(3)
 --------->AHL20(3)
--------->AHL12(3)
--------->AHL25(3)
<---------AHL25(1)
--------->AHL25(1)
<---------AHL12(3)
<---------AHL12(1)
<---------AHL20(2)
--------->AHL20(2)
--------->AHL12(1)
---------AHL12(2)
--------AHL12(2)
------>AHL20(2)
-------AHL25(3)
------AHL20(3)
------AHL12(3)
----->AHL20(3)
----->AHL25(3)
----->AHL25(1)
------AHL20(2)
----->AHL12(3)
------AHL25(1)
----->AHL20(2)
----->AHL12(1)
------AHL12(1)                                <---------AHL25(1)
-----AHL12(2)                                 <---------AHL20(2)
---->AHL12(2)                                 <---------AHL12(3)
----AHL12(2)                                 --------->AHL20(1)
---AHL25(3)                                  --------->AHL25(3)
-->AHL20(2)                                  <---------AHL20(1)           --------->RVE1(2)
->AHL12(3)                                  <---------AHL12(2)           <---------CCA1(2)
--AHL20(2)                                  --------->AHL12(3)    --------->KAN1
->AHL20(2)                                  <---------AHL12(3)   <---------ZAT14
->AHL25(3)                                  --------->AHL12(2)   --------->ARR11(2)
->AHL12(1)                                 <---------AHL20(1)    <---------ARR14(2)
->AHL25(1)                                 --------->AHL20(1)    --------->ARR14(2)              <--
--AHL12(3)                                 <---------AHL25(3)    <---------ARR11(2)             ----
--AHL12(1)                                --------->AHL12(3)     --------->ZAT14                ----
--AHL25(1)                                --------->AHL20(2)   --------->LBD16                  <---
-------->AHL12(2)                         --------->AHL25(1)  <---------ANAC46               <------
 
taaataaattagaaacttacaaactatattttagttctaactcaaatatatatttgactgtgtctccgtatactctatatccatgaaattagagttttac  1013500
<- Previous    Next ->

AGI:  At4g02300.1   
Description:  pectinesterase family protein. similar to pectinesterase family protein [Arabidopsis thaliana] (TAIR:AT4G02320.1); similar to hypothetical protein OsJ_024553 [Oryza sativa (japonica cultivar-group)] (GB:EAZ41070.1); similar to Os07g0675100 [Oryza sativa (japonica cultivar-group)] (GB:NP_001060620.1); similar to hypothetical protein OsI_026353 [Oryza sativa (indica cultivar-group)] (GB:EAZ05121.1); contains InterPro domain Pectin lyase fold (InterPro:IPR012334); contains InterPro domain Pectinesterase, catalytic; (InterPro:IPR000070); contains InterPro domain Pectin lyase fold/virulence factor (InterPro:IPR011050); contains InterPro domain Pec
Range:  from: 1009366    to: 1013034    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version