AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                <---
                                                                                                <---
                                                                                                ----
                                                                                                <---
                                                                                                ----
                                                                                                ----
                                                                                                ----
                                                                                        ----------->GT1
                                                                                    <---------AHL25(1)
                            --------->YAB1                                          --------->AHL25(2)
                          <---------AHL12(2)                                        <---------AHL25(3)
                         --------->AHL12(2)                    <---------WOX13(2)   --------->AHL20(2)
                        <---------AHL20(2)                   <---------AHL20(2)     --------->AHL25(1)
                <-----------GT1                           ----------->GT1           <---------AHL20(2)
              --------->WOX13(2)                   --------->AHL20(2)               <---------AHL20(3)
            --------->AHL25(1)                     <---------AHL25(1)              --------->AHL20(2)
            --------->AHL12(3)     --------->ALFIN1<---------AHL20(3)              <---------AHL20(2)
            --------->AHL25(3)   xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)              --------->YAB1
  --------->CCA1(2)     --------->AHL20(2)         <---------AHL20(2)            <---------AHL12(2)
 --------->ARR11(3) ------>ZmHOX2a(1)              --------->AHL25(1)            --------->AHL12(2)
 <---------ARR11(3)--------------->AGL15           <---------AHL25(3)            --------->WOX13(2)
-->YAB1     <---------AHL20(2)  --------->DAG2    --------->YAB1   <---------YAB1<---------WOX13(2)-
--YAB1      <---------AHL25(1)  <---------TOE2(3) --------->AHL25(1)            --------->YAB5  <---
--YAB5      --------->AHL20(2)  --------->DOF5.7(1)--------->AHL25(2)         <---------RVE1(2) <---
--GT1  <-------TEIL--------->TOE2(3)              --------->AHL20(2)        ----------->GT1  -------
 
ataagatatatacatataatttccttataaattataaggtggaacgtatagaattaaaatgtagtttattatgttgaaatagataattaaaatgtataat  324700
                                     <---------ICU4
                                     <---------AHL12(1)
                                     <---------AHL25(3)
                                    --------->AHL12(1)
                                    <---------AHL12(1)
                                    <---------AHL25(2)
                                    <---------AHL20(2)
                                    --------->AHL25(1)
                                    <---------AHL25(1)
                          <---------AHL25(1)
                          <---------AHL20(2)   --------->AHL20(1)
                         --------->AHL25(3)    <---------AHL20(1)
                        --------->AHL12(2)    <---------AHL12(2)
                        --------->WOX13(2)    --------->AHL12(2)
                      <---------AHL12(3)     <---------AHL25(3)
                      <---------AHL12(1)     XXXXXXXXXXXXXXXXXXXX>MIR857
                      <---------AHL25(1)    --------->AHL12(3)
                      <---------AHL25(3)    --------->AHL20(2)
                      --------->AHL25(1)    <---------AHL20(2)
                      --------->AHL12(3)    <---------AHL12(3)
                      --------->AHL12(1)    --------->AHL20(3)
                      --------->AHL20(2)    <---------AHL12(1)
                      <---------AHL20(2)    --------->AHL25(1)
                     --------->AHL25(2)     <---------AHL25(1)
                     --------->AHL20(1)     <---------AHL20(3)
                     <---------AHL25(2)     --------->YAB1
                     --------->AHL25(3)   <---------AHL12(2)
                     <---------AHL25(3)   --------->WOX13(2)
                     --------->AHL12(1)   <---------WOX13(2)
                     <---------AHL12(1)  <---------ICU4
                     <---------AHL25(1)  --------->YAB1
                     --------->AHL25(1) --------->AHL25(3)
                     <---------AHL20(1) --------->AHL25(1)
                     --------->AHL20(2) <---------AHL25(1)
                     <---------AHL20(2) <---------AHL12(1)
                     <---------AHL12(3) --------->AHL12(1)
                     --------->AHL12(3) --------->AHL20(2)
                    --------->AHL25(2)  <---------AHL20(2)
                    <---------AHL25(2) <---------YAB1                                           <---
                    --------->AHL12(3) <---------AHL12(2)                                       <---
                    <---------AHL12(3) --------->AHL12(2)                                      <----
                    <---------AHL12(2)<---------AHL12(2)                                    <-------
            --------->ATHB12        --------->AHL25(2)                                     ---------
            --------->YAB5<---------AHL25(3)--------->AHL12(1)                             <--------
            ----------->GT1         --------->ICU4                                     --------->AHL20(2)
   <XXXXXXXXXXXXXXXXXXXXMIR407      --------->AHL25(3)                                 <---------AHL20(2)
------AHL20(3)      --------->AHL12(2)--------->AHL12(2)                          --------->AHL12(2)
------AHL25(1)     --------->AHL12(2)-------->ATHB1                             <---------AHL12(3)
----->AHL20(3)  --------->AHL25(1)  <---------AHL12(3)                          <---------AHL20(2)
------AHL20(2)  <---------AHL25(1)  --------->AHL20(2)                          --------->AHL20(2)
----->AHL20(2)  <---------AHL25(2)  --------->AHL20(1)                          <---------AHL25(3)
----->AHL25(1)  <---------AHL20(2)  <---------YAB1  <---------AHL20(2)          --------->AHL12(3)
----->AHL25(2)  <---------AHL20(3) --------->AHL20(3)                           <---------AHL20(3)
-------->RVE1(2)--------->AHL20(2) <---------AHL25(2)                           --------->AHL25(3)--
------AHL25(3)  --------->AHL20(3) --------->AHL25(2)                           <---------AHL25(1)--
------AHL25(2)  <---------AHL12(3) --------->AHL12(2)                    <-----------GT1 --------->AHL12(2)
-->YAB1    <---------YAB1--------->AHL20(2)<---------YAB5         --------->YAB5--------->AHL25(1)--
 
aaaatcaaatgtgtatgattaaaatttatttaatacaaaattattaattatatattaaaaatgtatggataactatttactatttaaattttaaatatta  324800
              --------->AHL20(2)
              --------->AHL12(3)
              --------->AHL25(1)
              <---------AHL20(2)
              <---------AHL25(3)
              <---------AHL25(1)
              <---------AHL12(3)
            --------->AHL12(3)
            --------->AHL20(2)
            --------->AHL20(3)                                              --------->AHL25(3)
            <---------AHL20(3)                                          --------->AHL25(1)
           --------->WOX13(2)                                           <---------AHL25(1)
         <---------AHL12(3)                                             <---------AHL25(2)
         --------->AHL12(3)                                             <---------AHL25(3)
         --------->AHL20(2)                                             --------->AHL25(2)
         <---------AHL20(2)                                             <---------AHL20(3)
         --------->AHL25(3)                                             --------->AHL25(3)
         --------->AHL25(1)                                             --------->AHL20(1)
         --------->AHL20(1)                                             <---------AHL20(1)
         --------->AHL25(2)                                             --------->AHL20(2)
         <---------AHL25(3)                                         --------->AHL12(1)
         <---------AHL25(2)                                         <---------AHL20(2)
        <---------AHL20(2)                                          --------->AHL12(3)
        --------->AHL20(2)                                          <---------AHL12(3)
        --------->AHL12(3)                                         --------->AHL20(1)
        --------->AHL25(1)                                         <---------AHL20(1)
        <---------AHL12(3)                                        <---------AHL12(2)
        --------->AHL25(2)                                        --------->AHL12(2)
        <---------AHL25(2)                                       <---------AHL25(3)
        --------->AHL25(3)                                      <---------AHL12(3)
        <---------AHL25(1)                                      --------->AHL12(3)
        <---------AHL12(1)                                      --------->AHL20(3)
        <---------AHL25(3)                                      <---------AHL12(1)
        --------->AHL12(1)                                      <---------AHL20(3)
      <---------AHL12(2)                                        --------->AHL12(1)
    <---------AHL20(3)                                          --------->YAB1
    <---------AHL25(2)                                          <---------AHL20(2)
    --------->AHL12(1)                                          <---------AHL25(1)
    --------->AHL25(3)                                          --------->AHL25(1)
    --------->AHL20(2)                                          --------->AHL20(2)
    <---------AHL25(1)                                         <---------YAB1<---------AHL20(2)
    <---------AHL20(2)                                        <---------AHL20(3)
    --------->AHL25(1)                                        --------->AHL20(3)
    <---------AHL12(1)                                        --------->WOX13(2)
    --------->AHL25(2)                                        <---------WOX13(2)
    --------->AHL20(3)                                       <--------HAHB4 --------->AHL20(2)     -
  --------->AHL12(2)                                         <---------ICU4 <---------AHL20(2)   <--
------TOE1(3)<---------AHL25(3)                             <---------YAB1<---------WOX13(2)     <--
------TOE2(3)--------->AHL25(3)      --------->At4g35610    --------->ICU4--------->WOX13(2)    <---
-------GT1 --------->AHL12(2)        <---------At4g35610  --------->YAB1<---------AHL20(2)      ----
--AHL12(2)<---------AHL12(2)   --------->AHL12(1)        <---------YAB5 --------->AHL20(3)    <-----
>AHL12(1)<---------AHL25(1)    --------->AHL20(2)     --------->KAN1<---------AHL25(1)       <------
-AHL12(1)<---------AHL20(1)    <---------AHL12(1) <---------AHL20(2)<---------AHL12(1)       <------
------->YAB5<---------AHL12(3)<---------YAB1 --------->AHL25(3)<---------YAB5<---------AHL25(3)-----
------->TOE2(3)        --------->ZAT6<---------ZAT2  <---------RVE1(2)--------->AHL12(2)<---------ZAT6
------->TOE1(3)      <-----------GT1 --------->ZAT2  <---------YAB5--------->AHL25(3) <---------ANAC46
 
acgataaaaaattaaatttatattttacacttgattatttagctgggttttatttagttattcataattatatattttattaaatagttttgtgttaatg  324900
      <----------DOF2                            <---------WOX13(2)
      <---------DAG2                             <---------AHL12(2)
 <-----------GT1                              --------->AHL20(2)
-------->KAN1                          --------->At4g35610
-------CCA1(1)           ---------->DOF2    --------->ANAC58  <---------YAB5
-------RVE1(1)           --------->DOF5.7(1)--------->ANAC58--------->ARR11(2)
------ARR11(3)    ------->GAMYB--------->DOF5.7(1)<---------AHL20(2)
----->ARR11(3)   --------->MYB46(3)  <--------P  --------->AHL12(2)        ------------>CBF
----YAB5        --------->ANAC58    <-------GAMYB--------->WOX13(2) <---------GATA12 ------------>CBF
---TOE2(3)      --------->ANAC58   <---------MYB46(3) --------->ANAC46------------>CBF             <
---WOX13(2)   --------->MYB46(3)------------>AtMYB77 <---------YAB5 <---------ARR11(2)    ----------
---->YAB1   --------->ANAC46 ---------->DOF2----------->GT1 <---------ARR11(2)  ------------>CBF  --
 
atattttcgctttagccacaaccaaaaaaaaagaaagacggttgctcaagtaaataaacgtcgtaatcgccgattcaattcaattcaattcaattcaatt  325000
                                                    <-----------GT1
                                                --------->AHL25(3)
                                                --------->AHL12(3)
                                                <---------AHL12(3)
                                                <---------AHL25(2)
                                                <---------AHL20(3)
                                                --------->AHL20(3)
                                                <---------AHL20(2)
                                                <---------AHL25(1)                <-----------GT1
                                          <------MYB83                          --------->KAN4(2)  <
                                          ----------->GT1                      <---------AHL12(1)  -
             <----------DOF2              <------MYB46(1)                      --------->KAN1      -
       --------->AtMYB61                  <---------ANAC55(2)      <---------MYB52(1)        <------
---------TOE1(2)                         --------->MYB59           <---------DOF5.7(1)<----------DOF2
-->CBF--------->MYB46(3)            <---------ARR11(3)          *TSS           --------->AHL12(1) --
---->ZmHOX2a(1)          <---------HSFB2a(2)   --------->AHL12(2) <---------DOF5.7(1)<---------DOF5.7(1)
 
cctagggtcaccatcgctctatctcattctcgataagaagacattaggtatattatttctctctgttcccgttttctctgaaatattccctttcgataca  325100
                                                                   --------->At4g35610
                               <---------MYB52(1)                  <---------At4g35610
                             ----------->GT1                    <---------YAB5
                           ------->TEIL                      --------->KAN1
<---------AHL25(1)   --------->GLK1(2)                     <---------ANAC58
<---------AHL20(2)   <---------ARR14(2)                    <---------ANAC58
<---------AHL12(3)   --------->RVE1(2)                --------->MYB52(2)
---------AHL20(1)    <-----------ARR10                <-----------RAV1(1)
-------->AHL20(1)    --------->ARR14(2)               <---------MYB46(3)
-------->AHL25(3)    --------->GATA12     --------->YAB5   <---------ANAC46        <----------DOF2
-TEIL                <---------GATA12     --------->KAN1---------->ID1   <---------KAN1
------->AHL12(3)------>ZmHOX2a(1)  <-----------GT1  <---------MYB52(1) <---------GLK1(2)     -------
 
tatatatttgagtctcttcctccaaatctgaaccgtttatacctctgattccaccgcttgttgcttattcatcggaatttctgttccttttgtgccaaat  325200
                                                                                                 <--
                       --------->WOX13(2)                     ----------->GT1                    <--
           --------->DAG2      <---------MYB46(3)             <---------ANAC58                   <--
 --------->ANAC58  ----------->GT1      <---------YAB1        <---------ANAC46                   <--
 --------->ANAC58<---------ANAC46   <---------RVE1(2)         <---------ANAC58                  <---
-->KAN1   ---------->DOF2    <-------GAMYB           <---------DOF5.7(1)                      <-----
 
gctcaagaaatcgaaaagtattgtgtaattttcgttgttgattttgaaagtttcaatcttttgtagggtgagaattgagttttatcgaacaagatggatt  325300
                    --------->ANAC58
                    <---------O2
                    --------->TGA1a
                    --------->ANAC46
                    --------->ANAC58
                    --------->bZIP60(2)                    <---------RVE1(2)
                    --------->O2                           --------->ARR14(2)                   <---
                    <---------TGA1a                        --------->ARR11(3)                  -----
       --------->YAB1                                      <---------ARR14(2)            --------->ZAT2
     --------->GLK1(2)                                     <---------ARR11(3)        --------->ANAC58
-------ANAC46     <---------ALFIN1                    <-----------HVH21     <---------ZAT14   <-----
-------ANAC58   >>>>>>>>>>DREB1A                     --------->WOX13(1)     <---------ZAT18   ------
-------ANAC55(2)>>>>>>>>>>DREB2A                    ------>ZmHOX2a(2)       --------->ZAT14------>ZmHOX2a(1)
-------ANAC58  <---------ETT(1)                   --------->RVE1(2)  ----------->HVH21   -----------
--------------------TaNAC69(2)              <---------HSFB2a(2)    <---------ANAC58  --------->ANAC46
----GLK1(1)   --------->DEAR3(2)            --------->HSFB2a(2)    <---------ANAC58  --------->ANAC58
 
tcgtgaacaatcttgataccgacacgtcgctatcaattctctcttgtctagatgatccatcagatattgtccgtgccagtgctgtctcacgctcctggcg  325400
                              --------->YAB1
   <------MYB46(1)    ------>ZmHOX2a(1)    <<<<<<<<<GATA-1
   <------MYB83   <---------ARR14(2)      <-----------GT1                        <------MYB83
  --------->MYB59 --------->GLK1(2)<---------YAB5                                <------MYB46(1)
---NtERF2         --------->ARR14(2)    <---------AHL20(2)        ------->TEIL  <---------MYB46(3)
->NtERF2          --------->ARR11(2)  --------->AHL12(2)          --------->GATA12
----ETT(2)       <---------GLK1(2)<---------WOX13(2)         <-------GAMYB  <---------AtMYB61
--->ETT(2)    --------->YAB1  --------->TOE2(3)             <-----------RAV1(1)<---------ANAC46
>RAV1(2)     --------->At4g35610 --------->MYB52(2)    --------->YAB5      <---------ZAT14       <--
 
acaatttggtaatctcatcagaatcctcttcaatgttagttattttatctatcttcaatgtttctgttgaatcttgagtatggtgggtttgcatttgcag  325500
                                                                                  --------->YAB1
                                                                                  -------->HAHB4
                                                                                  --------->ATHB12
                                                                                 --------->ICU4
                                                                            <---------ANAC55(2)
                                                                            --------->ANAC58
                                                                            --------->ANAC46
                                                                            --------->ANAC55(2)
                                                                   <---------WOX13(2)
                                                                   --------->WOX13(2)
                           <---------ANAC58                      <---------AHL20(2)
                           <---------ANAC58                      <---------AHL25(1)
                         <---------YAB1                          --------->AHL25(1)
                    <-----------ARR10                       <------ZmHOX2a(2)    <---------YAB1
     --------->ZAT14--------->GLK1(2)                      <---------GATA12 --------->ANAC55(1)
  <---------ANAC46  --------->RVE1(2)                   --------->ALFIN1    --------->ANAC58
  <---------ANAC55(2)<---------KAN1          --------->At4g35610 --------->AHL20(2)
-------MYB46(3)    <---------GLK1(2)         <---------At4g35610 <---------YAB1  <---------YAB5  <--
 
tggttaagtatagtctctccaagaatctatgcttgaagttgttccatcagctatctaatgtggatcatataattgaaacaagtaatgatagaaatggaga  325600
<- Previous    Next ->

AGI:  At4g00755.1   
Description:  F-box family protein. similar to unnamed protein product [Vitis vinifera] (GB:CAO70395.1); contains InterPro domain Cyclin-like F-box (InterPro:IPR001810)
Range:  from: 325065    to: 327008    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version